Incidental Mutation 'R6356:Med23'
ID513021
Institutional Source Beutler Lab
Gene Symbol Med23
Ensembl Gene ENSMUSG00000019984
Gene Namemediator complex subunit 23
SynonymsX83317, 3000002A17Rik, ESTM7, Crsp3, Sur2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6356 (G1)
Quality Score213.009
Status Not validated
Chromosome10
Chromosomal Location24869986-24913681 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 24888413 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 98 (C98F)
Ref Sequence ENSEMBL: ENSMUSP00000134836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020159] [ENSMUST00000092646] [ENSMUST00000176285] [ENSMUST00000176502] [ENSMUST00000177232]
Predicted Effect probably damaging
Transcript: ENSMUST00000020159
AA Change: C300F

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020159
Gene: ENSMUSG00000019984
AA Change: C300F

DomainStartEndE-ValueType
Pfam:Med23 3 1310 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000092646
AA Change: C306F

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000090316
Gene: ENSMUSG00000019984
AA Change: C306F

DomainStartEndE-ValueType
Pfam:Med23 4 1316 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175786
Predicted Effect probably benign
Transcript: ENSMUST00000176285
SMART Domains Protein: ENSMUSP00000135232
Gene: ENSMUSG00000019984

DomainStartEndE-ValueType
Pfam:Med23 1 51 4.4e-14 PFAM
Pfam:Med23 48 950 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176502
AA Change: C98F

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134836
Gene: ENSMUSG00000019984
AA Change: C98F

DomainStartEndE-ValueType
Pfam:Med23 1 95 8.7e-36 PFAM
Pfam:Med23 92 234 3.8e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176827
Predicted Effect probably benign
Transcript: ENSMUST00000177232
SMART Domains Protein: ENSMUSP00000134866
Gene: ENSMUSG00000019984

DomainStartEndE-ValueType
Pfam:Med23 3 58 1.2e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177522
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. This protein also acts as a metastasis suppressor. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis with disorganization of the vasculature and peripheral nervous system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,254,009 S152T probably benign Het
Aass A G 6: 23,093,902 V140A probably damaging Het
Add1 A G 5: 34,619,396 N32S probably null Het
Agap2 T C 10: 127,082,996 S414P unknown Het
Arhgef38 A G 3: 133,140,877 F376L probably benign Het
Cd22 A T 7: 30,877,702 I60N probably damaging Het
Cdh23 T A 10: 60,438,847 D488V probably damaging Het
Cox16 T G 12: 81,472,341 D148A probably damaging Het
Dclre1b G A 3: 103,808,155 T9I probably damaging Het
Dennd4c T C 4: 86,825,449 V1176A probably benign Het
Echdc1 A C 10: 29,344,526 probably null Het
Efnb3 G A 11: 69,556,140 A248V probably benign Het
Glud1 A G 14: 34,311,216 R107G probably benign Het
Gm11639 A G 11: 104,893,707 K2772E probably benign Het
Gtf2h4 A G 17: 35,669,755 S279P probably damaging Het
Hectd1 A G 12: 51,744,619 C2579R probably damaging Het
Igkv15-103 A G 6: 68,437,457 probably benign Het
Ivl CCTGCTGCTGCTGCT CCTGCTGCTGCT 3: 92,571,910 probably benign Het
Krtap5-2 T C 7: 142,175,382 probably benign Het
Lcn11 G T 2: 25,778,120 G97* probably null Het
Lrrtm3 G A 10: 63,930,164 T548M probably benign Het
Map3k2 A T 18: 32,211,970 T283S probably damaging Het
Mast4 T C 13: 102,735,985 K2292E possibly damaging Het
Morc1 T A 16: 48,437,289 F26Y probably damaging Het
Muc5ac T A 7: 141,812,679 M2160K probably benign Het
Myocd T C 11: 65,218,570 probably null Het
Nup160 T A 2: 90,711,935 probably null Het
Olfr812 T A 10: 129,842,608 S145C probably benign Het
Olfr993 T A 2: 85,414,687 Q64L probably damaging Het
Olr1 A T 6: 129,493,559 L215Q probably benign Het
Pik3c2a T C 7: 116,348,205 K1414R possibly damaging Het
Ppfibp2 T C 7: 107,681,769 V96A probably benign Het
Prim1 T A 10: 128,023,835 Y299N probably damaging Het
Rnf219 A G 14: 104,478,877 S687P probably damaging Het
Rsf1 T C 7: 97,661,934 S624P probably benign Het
Samd4b A T 7: 28,401,593 I687N probably damaging Het
Sbf2 A T 7: 110,372,623 F801L probably damaging Het
St6gal2 T C 17: 55,482,013 I16T probably damaging Het
Tiam2 CGGG CGGGG 17: 3,414,622 probably null Het
Trim8 T G 19: 46,515,358 S450A probably benign Het
Trp53bp2 A G 1: 182,448,997 T848A probably benign Het
Vmn2r24 A G 6: 123,806,409 S523G possibly damaging Het
Vmn2r52 T A 7: 10,168,999 M501L probably benign Het
Vmn2r68 C T 7: 85,233,840 V235M possibly damaging Het
Wdr66 G A 5: 123,254,666 probably benign Het
Zfhx3 G A 8: 108,946,619 V1434M probably damaging Het
Zmym5 A T 14: 56,794,165 N495K possibly damaging Het
Other mutations in Med23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00670:Med23 APN 10 24888584 missense probably damaging 1.00
IGL00792:Med23 APN 10 24877004 missense possibly damaging 0.93
IGL01289:Med23 APN 10 24902121 missense probably damaging 1.00
IGL01469:Med23 APN 10 24882597 missense probably damaging 1.00
IGL01598:Med23 APN 10 24903798 missense probably benign 0.34
IGL02324:Med23 APN 10 24897341 missense probably damaging 0.98
IGL02381:Med23 APN 10 24900728 missense possibly damaging 0.95
IGL02465:Med23 APN 10 24903743 missense probably damaging 0.96
IGL02554:Med23 APN 10 24898575 critical splice donor site probably null
IGL02683:Med23 APN 10 24870717 missense probably benign 0.00
PIT4362001:Med23 UTSW 10 24874571 missense probably benign 0.01
R0080:Med23 UTSW 10 24912817 missense probably benign 0.33
R0125:Med23 UTSW 10 24900788 missense probably damaging 1.00
R0311:Med23 UTSW 10 24897358 missense possibly damaging 0.95
R0765:Med23 UTSW 10 24900710 missense probably damaging 1.00
R1302:Med23 UTSW 10 24888422 splice site probably null
R1456:Med23 UTSW 10 24903652 splice site probably benign
R1514:Med23 UTSW 10 24892667 splice site probably benign
R1774:Med23 UTSW 10 24903686 missense probably damaging 1.00
R1851:Med23 UTSW 10 24910870 splice site probably null
R1928:Med23 UTSW 10 24909812 missense probably benign
R1975:Med23 UTSW 10 24910766 missense probably benign 0.01
R2011:Med23 UTSW 10 24879755 missense possibly damaging 0.63
R2266:Med23 UTSW 10 24874601 missense probably benign 0.00
R2309:Med23 UTSW 10 24870688 missense probably damaging 0.99
R2507:Med23 UTSW 10 24910813 missense probably damaging 1.00
R2566:Med23 UTSW 10 24888575 missense probably damaging 1.00
R3720:Med23 UTSW 10 24891120 missense probably damaging 1.00
R3771:Med23 UTSW 10 24902201 missense probably damaging 1.00
R3811:Med23 UTSW 10 24892592 nonsense probably null
R3811:Med23 UTSW 10 24892593 splice site probably null
R4305:Med23 UTSW 10 24904270 nonsense probably null
R4323:Med23 UTSW 10 24870705 missense probably benign 0.02
R4701:Med23 UTSW 10 24893648 missense probably damaging 1.00
R4886:Med23 UTSW 10 24874683 critical splice donor site probably null
R4925:Med23 UTSW 10 24910747 missense probably damaging 1.00
R4943:Med23 UTSW 10 24875669 missense possibly damaging 0.92
R5207:Med23 UTSW 10 24895836 nonsense probably null
R5749:Med23 UTSW 10 24888449 missense possibly damaging 0.84
R5806:Med23 UTSW 10 24907221 missense probably damaging 1.00
R5896:Med23 UTSW 10 24902145 missense probably damaging 1.00
R5954:Med23 UTSW 10 24870483 splice site probably benign
R6031:Med23 UTSW 10 24903748 nonsense probably null
R6031:Med23 UTSW 10 24903748 nonsense probably null
R6093:Med23 UTSW 10 24878443 missense probably benign 0.16
R6107:Med23 UTSW 10 24906034 nonsense probably null
R6393:Med23 UTSW 10 24873476 missense possibly damaging 0.91
R6533:Med23 UTSW 10 24893620 missense probably damaging 1.00
R6911:Med23 UTSW 10 24902181 missense probably damaging 0.98
R6981:Med23 UTSW 10 24895824 missense possibly damaging 0.92
R7085:Med23 UTSW 10 24870121 missense probably damaging 1.00
R7215:Med23 UTSW 10 24888429 missense probably benign
R7229:Med23 UTSW 10 24902004 missense probably benign
R7489:Med23 UTSW 10 24904356 missense probably damaging 1.00
R7530:Med23 UTSW 10 24905953 missense probably benign 0.00
R7643:Med23 UTSW 10 24905965 missense probably benign 0.01
R7653:Med23 UTSW 10 24904384 missense probably damaging 1.00
R7764:Med23 UTSW 10 24909920 critical splice donor site probably null
R7784:Med23 UTSW 10 24902448 missense probably damaging 1.00
R8024:Med23 UTSW 10 24879683 missense possibly damaging 0.74
R8182:Med23 UTSW 10 24912807 missense probably benign
R8412:Med23 UTSW 10 24908734 missense probably benign 0.01
R8874:Med23 UTSW 10 24895719 missense possibly damaging 0.92
RF003:Med23 UTSW 10 24903785 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTAACAGGACAGGATGCAGC -3'
(R):5'- GTGCTCAAAGCCAACTAAGC -3'

Sequencing Primer
(F):5'- ACAGGATGCAGCTTTAATAGACTAG -3'
(R):5'- AGCAGCAGGATTGGCTCTG -3'
Posted On2018-04-27