Incidental Mutation 'R6356:Efnb3'
ID513029
Institutional Source Beutler Lab
Gene Symbol Efnb3
Ensembl Gene ENSMUSG00000003934
Gene Nameephrin B3
SynonymsEpl8, EFL-6, Elk-L3, ELF-3, LERK-8, NLERK-2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6356 (G1)
Quality Score197.009
Status Not validated
Chromosome11
Chromosomal Location69554092-69560205 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 69556140 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 248 (A248V)
Ref Sequence ENSEMBL: ENSMUSP00000004036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004036]
PDB Structure
Crystal Structures of Nipah Virus G Attachment Glycoprotein in Complex with its Receptor Ephrin-B3 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000004036
AA Change: A248V

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000004036
Gene: ENSMUSG00000003934
AA Change: A248V

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Ephrin 28 167 2.8e-45 PFAM
transmembrane domain 225 247 N/A INTRINSIC
low complexity region 264 291 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] EFNB3, a member of the ephrin gene family, is important in brain development as well as in its maintenance. Moreover, since levels of EFNB3 expression were particularly high in several forebrain subregions compared to other brain subregions, it may play a pivotal role in forebrain function. The EPH and EPH-related receptors comprise the largest subfamily of receptor protein-tyrosine kinases and have been implicated in mediating developmental events, particularly in the nervous system. EPH Receptors typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin ligands and receptors have been named by the Eph Nomenclature Committee (1997). Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are similarly divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for null mutations exhibit a hopping gait due to corticospinal tract defects, mutations that remove only the cytoplasmic domain of the protein do not result in the gait or CNS phenotypes, and a G244E mutation causes ataxia [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,254,009 S152T probably benign Het
Aass A G 6: 23,093,902 V140A probably damaging Het
Add1 A G 5: 34,619,396 N32S probably null Het
Agap2 T C 10: 127,082,996 S414P unknown Het
Arhgef38 A G 3: 133,140,877 F376L probably benign Het
Cd22 A T 7: 30,877,702 I60N probably damaging Het
Cdh23 T A 10: 60,438,847 D488V probably damaging Het
Cox16 T G 12: 81,472,341 D148A probably damaging Het
Dclre1b G A 3: 103,808,155 T9I probably damaging Het
Dennd4c T C 4: 86,825,449 V1176A probably benign Het
Echdc1 A C 10: 29,344,526 probably null Het
Glud1 A G 14: 34,311,216 R107G probably benign Het
Gm11639 A G 11: 104,893,707 K2772E probably benign Het
Gtf2h4 A G 17: 35,669,755 S279P probably damaging Het
Hectd1 A G 12: 51,744,619 C2579R probably damaging Het
Igkv15-103 A G 6: 68,437,457 probably benign Het
Ivl CCTGCTGCTGCTGCT CCTGCTGCTGCT 3: 92,571,910 probably benign Het
Krtap5-2 T C 7: 142,175,382 probably benign Het
Lcn11 G T 2: 25,778,120 G97* probably null Het
Lrrtm3 G A 10: 63,930,164 T548M probably benign Het
Map3k2 A T 18: 32,211,970 T283S probably damaging Het
Mast4 T C 13: 102,735,985 K2292E possibly damaging Het
Med23 G T 10: 24,888,413 C98F probably damaging Het
Morc1 T A 16: 48,437,289 F26Y probably damaging Het
Muc5ac T A 7: 141,812,679 M2160K probably benign Het
Myocd T C 11: 65,218,570 probably null Het
Nup160 T A 2: 90,711,935 probably null Het
Olfr812 T A 10: 129,842,608 S145C probably benign Het
Olfr993 T A 2: 85,414,687 Q64L probably damaging Het
Olr1 A T 6: 129,493,559 L215Q probably benign Het
Pik3c2a T C 7: 116,348,205 K1414R possibly damaging Het
Ppfibp2 T C 7: 107,681,769 V96A probably benign Het
Prim1 T A 10: 128,023,835 Y299N probably damaging Het
Rnf219 A G 14: 104,478,877 S687P probably damaging Het
Rsf1 T C 7: 97,661,934 S624P probably benign Het
Samd4b A T 7: 28,401,593 I687N probably damaging Het
Sbf2 A T 7: 110,372,623 F801L probably damaging Het
St6gal2 T C 17: 55,482,013 I16T probably damaging Het
Tiam2 CGGG CGGGG 17: 3,414,622 probably null Het
Trim8 T G 19: 46,515,358 S450A probably benign Het
Trp53bp2 A G 1: 182,448,997 T848A probably benign Het
Vmn2r24 A G 6: 123,806,409 S523G possibly damaging Het
Vmn2r52 T A 7: 10,168,999 M501L probably benign Het
Vmn2r68 C T 7: 85,233,840 V235M possibly damaging Het
Wdr66 G A 5: 123,254,666 probably benign Het
Zfhx3 G A 8: 108,946,619 V1434M probably damaging Het
Zmym5 A T 14: 56,794,165 N495K possibly damaging Het
Other mutations in Efnb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01995:Efnb3 APN 11 69556904 critical splice donor site probably null
IGL03114:Efnb3 APN 11 69556802 unclassified probably benign
IGL03328:Efnb3 APN 11 69557205 missense probably damaging 1.00
turtle UTSW 11 69557283 missense probably damaging 1.00
R0621:Efnb3 UTSW 11 69555972 missense probably damaging 1.00
R4366:Efnb3 UTSW 11 69555945 missense probably damaging 1.00
R6215:Efnb3 UTSW 11 69556765 missense probably benign 0.05
R7638:Efnb3 UTSW 11 69557220 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- TACACAGGGTGCCCATAGTCAC -3'
(R):5'- ATATCCAGATGGTTCCTTCAGCC -3'

Sequencing Primer
(F):5'- CCTTCTCGTAGTGAGGGCAGAAG -3'
(R):5'- GATGGTTCCTTCAGCCCCTCC -3'
Posted On2018-04-27