Incidental Mutation 'R6356:Hectd1'
ID513031
Institutional Source Beutler Lab
Gene Symbol Hectd1
Ensembl Gene ENSMUSG00000035247
Gene NameHECT domain E3 ubiquitin protein ligase 1
Synonymsb2b327Clo, opm, A630086P08Rik
Accession Numbers

Genbank: NM_144788; MGI: 2384768

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6356 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location51743722-51829536 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51744619 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 2579 (C2579R)
Ref Sequence ENSEMBL: ENSMUSP00000046766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042052] [ENSMUST00000179265] [ENSMUST00000218820]
Predicted Effect probably damaging
Transcript: ENSMUST00000042052
AA Change: C2579R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046766
Gene: ENSMUSG00000035247
AA Change: C2579R

DomainStartEndE-ValueType
low complexity region 317 331 N/A INTRINSIC
ANK 395 424 1.44e-1 SMART
ANK 426 455 2.81e-4 SMART
ANK 459 488 1.55e2 SMART
low complexity region 490 509 N/A INTRINSIC
low complexity region 630 654 N/A INTRINSIC
low complexity region 707 723 N/A INTRINSIC
low complexity region 821 832 N/A INTRINSIC
Pfam:Sad1_UNC 1107 1240 9.2e-27 PFAM
low complexity region 1259 1271 N/A INTRINSIC
Pfam:MIB_HERC2 1277 1338 7.6e-27 PFAM
low complexity region 1373 1401 N/A INTRINSIC
low complexity region 1441 1458 N/A INTRINSIC
low complexity region 1484 1495 N/A INTRINSIC
low complexity region 1508 1524 N/A INTRINSIC
low complexity region 1600 1630 N/A INTRINSIC
low complexity region 1633 1651 N/A INTRINSIC
low complexity region 1674 1703 N/A INTRINSIC
low complexity region 1745 1752 N/A INTRINSIC
PDB:2LC3|A 1879 1966 4e-57 PDB
low complexity region 2101 2117 N/A INTRINSIC
HECTc 2143 2610 8.32e-76 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158721
Predicted Effect probably damaging
Transcript: ENSMUST00000179265
AA Change: C2587R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000136449
Gene: ENSMUSG00000035247
AA Change: C2587R

DomainStartEndE-ValueType
low complexity region 317 331 N/A INTRINSIC
ANK 396 425 1.44e-1 SMART
ANK 427 456 2.81e-4 SMART
ANK 460 489 1.55e2 SMART
low complexity region 491 510 N/A INTRINSIC
low complexity region 631 655 N/A INTRINSIC
low complexity region 708 724 N/A INTRINSIC
low complexity region 822 833 N/A INTRINSIC
Pfam:Sad1_UNC 1112 1245 1.3e-26 PFAM
low complexity region 1264 1276 N/A INTRINSIC
Pfam:MIB_HERC2 1282 1341 5.3e-26 PFAM
low complexity region 1378 1406 N/A INTRINSIC
low complexity region 1446 1463 N/A INTRINSIC
low complexity region 1489 1500 N/A INTRINSIC
low complexity region 1513 1529 N/A INTRINSIC
low complexity region 1605 1635 N/A INTRINSIC
low complexity region 1638 1656 N/A INTRINSIC
low complexity region 1679 1708 N/A INTRINSIC
low complexity region 1750 1757 N/A INTRINSIC
PDB:2LC3|A 1884 1971 3e-57 PDB
low complexity region 2106 2122 N/A INTRINSIC
HECTc 2148 2618 4.5e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000218820
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice that are homozygous for either a gene trapped or an ENU-induced allele exhibit exencephaly associated with impaired head mesenchyme development and neural tube closure, and show eye and cranial vault dysplasia. Homozygotes for another ENU-induced allele show congenital cardiovascular defects. [provided by MGI curators]
Allele List at MGI

All alleles(30) : Gene trapped(29) Chemically induced(1)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,254,009 S152T probably benign Het
Aass A G 6: 23,093,902 V140A probably damaging Het
Add1 A G 5: 34,619,396 N32S probably null Het
Agap2 T C 10: 127,082,996 S414P unknown Het
Arhgef38 A G 3: 133,140,877 F376L probably benign Het
Cd22 A T 7: 30,877,702 I60N probably damaging Het
Cdh23 T A 10: 60,438,847 D488V probably damaging Het
Cox16 T G 12: 81,472,341 D148A probably damaging Het
Dclre1b G A 3: 103,808,155 T9I probably damaging Het
Dennd4c T C 4: 86,825,449 V1176A probably benign Het
Echdc1 A C 10: 29,344,526 probably null Het
Efnb3 G A 11: 69,556,140 A248V probably benign Het
Glud1 A G 14: 34,311,216 R107G probably benign Het
Gm11639 A G 11: 104,893,707 K2772E probably benign Het
Gtf2h4 A G 17: 35,669,755 S279P probably damaging Het
Igkv15-103 A G 6: 68,437,457 probably benign Het
Ivl CCTGCTGCTGCTGCT CCTGCTGCTGCT 3: 92,571,910 probably benign Het
Krtap5-2 T C 7: 142,175,382 probably benign Het
Lcn11 G T 2: 25,778,120 G97* probably null Het
Lrrtm3 G A 10: 63,930,164 T548M probably benign Het
Map3k2 A T 18: 32,211,970 T283S probably damaging Het
Mast4 T C 13: 102,735,985 K2292E possibly damaging Het
Med23 G T 10: 24,888,413 C98F probably damaging Het
Morc1 T A 16: 48,437,289 F26Y probably damaging Het
Muc5ac T A 7: 141,812,679 M2160K probably benign Het
Myocd T C 11: 65,218,570 probably null Het
Nup160 T A 2: 90,711,935 probably null Het
Olfr812 T A 10: 129,842,608 S145C probably benign Het
Olfr993 T A 2: 85,414,687 Q64L probably damaging Het
Olr1 A T 6: 129,493,559 L215Q probably benign Het
Pik3c2a T C 7: 116,348,205 K1414R possibly damaging Het
Ppfibp2 T C 7: 107,681,769 V96A probably benign Het
Prim1 T A 10: 128,023,835 Y299N probably damaging Het
Rnf219 A G 14: 104,478,877 S687P probably damaging Het
Rsf1 T C 7: 97,661,934 S624P probably benign Het
Samd4b A T 7: 28,401,593 I687N probably damaging Het
Sbf2 A T 7: 110,372,623 F801L probably damaging Het
St6gal2 T C 17: 55,482,013 I16T probably damaging Het
Tiam2 CGGG CGGGG 17: 3,414,622 probably null Het
Trim8 T G 19: 46,515,358 S450A probably benign Het
Trp53bp2 A G 1: 182,448,997 T848A probably benign Het
Vmn2r24 A G 6: 123,806,409 S523G possibly damaging Het
Vmn2r52 T A 7: 10,168,999 M501L probably benign Het
Vmn2r68 C T 7: 85,233,840 V235M possibly damaging Het
Wdr66 G A 5: 123,254,666 probably benign Het
Zfhx3 G A 8: 108,946,619 V1434M probably damaging Het
Zmym5 A T 14: 56,794,165 N495K possibly damaging Het
Other mutations in Hectd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Hectd1 APN 12 51769108 missense possibly damaging 0.94
IGL00402:Hectd1 APN 12 51759432 missense probably benign
IGL00419:Hectd1 APN 12 51764035 missense probably damaging 0.99
IGL00518:Hectd1 APN 12 51776489 splice site probably benign
IGL00565:Hectd1 APN 12 51790398 missense probably damaging 0.97
IGL00574:Hectd1 APN 12 51774004 missense probably benign 0.17
IGL00576:Hectd1 APN 12 51759309 missense probably damaging 0.99
IGL00788:Hectd1 APN 12 51748788 missense probably damaging 0.99
IGL00978:Hectd1 APN 12 51791390 missense possibly damaging 0.95
IGL01328:Hectd1 APN 12 51761121 missense probably damaging 1.00
IGL01337:Hectd1 APN 12 51802274 missense possibly damaging 0.95
IGL01634:Hectd1 APN 12 51803779 missense probably damaging 0.98
IGL01731:Hectd1 APN 12 51802810 missense possibly damaging 0.59
IGL01920:Hectd1 APN 12 51782554 missense probably damaging 0.99
IGL01951:Hectd1 APN 12 51794497 nonsense probably null
IGL01994:Hectd1 APN 12 51797942 missense probably damaging 0.99
IGL02140:Hectd1 APN 12 51774137 missense probably damaging 0.99
IGL02150:Hectd1 APN 12 51769191 missense probably damaging 0.97
IGL02156:Hectd1 APN 12 51754133 splice site probably benign
IGL02177:Hectd1 APN 12 51772320 missense probably damaging 0.99
IGL02502:Hectd1 APN 12 51797852 missense possibly damaging 0.77
IGL02505:Hectd1 APN 12 51800713 critical splice donor site probably null
IGL02519:Hectd1 APN 12 51769111 missense probably damaging 0.99
IGL02624:Hectd1 APN 12 51762450 missense possibly damaging 0.61
IGL02833:Hectd1 APN 12 51764081 missense probably damaging 0.96
IGL02851:Hectd1 APN 12 51767640 missense possibly damaging 0.94
IGL02866:Hectd1 APN 12 51790613 missense probably damaging 1.00
IGL02981:Hectd1 APN 12 51768887 missense possibly damaging 0.70
IGL02987:Hectd1 APN 12 51744767 missense probably damaging 1.00
IGL02999:Hectd1 APN 12 51827422 missense possibly damaging 0.77
IGL03071:Hectd1 APN 12 51769174 missense probably benign 0.00
IGL03078:Hectd1 APN 12 51802236 missense probably damaging 0.98
IGL03299:Hectd1 APN 12 51800888 splice site probably benign
3-1:Hectd1 UTSW 12 51753807 missense probably damaging 0.99
R0039:Hectd1 UTSW 12 51753825 missense possibly damaging 0.83
R0238:Hectd1 UTSW 12 51769318 missense possibly damaging 0.72
R0238:Hectd1 UTSW 12 51769318 missense possibly damaging 0.72
R0239:Hectd1 UTSW 12 51769318 missense possibly damaging 0.72
R0239:Hectd1 UTSW 12 51769318 missense possibly damaging 0.72
R0268:Hectd1 UTSW 12 51769107 missense probably damaging 0.99
R0268:Hectd1 UTSW 12 51769108 missense possibly damaging 0.94
R0409:Hectd1 UTSW 12 51782556 missense possibly damaging 0.59
R1019:Hectd1 UTSW 12 51748657 missense probably damaging 0.99
R1072:Hectd1 UTSW 12 51761072 missense probably benign 0.11
R1087:Hectd1 UTSW 12 51776572 missense probably damaging 0.99
R1165:Hectd1 UTSW 12 51764164 splice site probably benign
R1350:Hectd1 UTSW 12 51762434 missense probably benign
R1553:Hectd1 UTSW 12 51773878 missense probably damaging 0.98
R1666:Hectd1 UTSW 12 51753824 missense possibly damaging 0.91
R1676:Hectd1 UTSW 12 51744788 missense probably damaging 1.00
R1694:Hectd1 UTSW 12 51744592 missense probably damaging 1.00
R1778:Hectd1 UTSW 12 51753807 missense probably damaging 0.99
R1856:Hectd1 UTSW 12 51744794 missense probably damaging 1.00
R1859:Hectd1 UTSW 12 51806567 missense probably damaging 1.00
R1884:Hectd1 UTSW 12 51800955 missense probably benign 0.00
R1982:Hectd1 UTSW 12 51785841 missense probably damaging 0.97
R2034:Hectd1 UTSW 12 51757116 splice site probably null
R2061:Hectd1 UTSW 12 51794444 missense probably damaging 0.99
R2078:Hectd1 UTSW 12 51748542 missense probably damaging 0.99
R2176:Hectd1 UTSW 12 51745494 missense probably damaging 1.00
R2210:Hectd1 UTSW 12 51806462 missense probably damaging 0.99
R2248:Hectd1 UTSW 12 51806471 missense probably damaging 0.99
R2282:Hectd1 UTSW 12 51769008 missense possibly damaging 0.95
R2402:Hectd1 UTSW 12 51745534 missense probably benign 0.01
R3876:Hectd1 UTSW 12 51768730 missense probably damaging 0.98
R4027:Hectd1 UTSW 12 51802436 critical splice acceptor site probably null
R4085:Hectd1 UTSW 12 51774750 missense possibly damaging 0.93
R4115:Hectd1 UTSW 12 51768723 nonsense probably null
R4116:Hectd1 UTSW 12 51768723 nonsense probably null
R4169:Hectd1 UTSW 12 51790225 missense probably damaging 0.97
R4434:Hectd1 UTSW 12 51752052 missense probably damaging 1.00
R4507:Hectd1 UTSW 12 51790493 missense probably damaging 0.97
R4578:Hectd1 UTSW 12 51751932 missense probably damaging 1.00
R4579:Hectd1 UTSW 12 51744573 missense probably damaging 0.97
R4709:Hectd1 UTSW 12 51787912 missense possibly damaging 0.94
R4812:Hectd1 UTSW 12 51827351 critical splice donor site probably null
R4883:Hectd1 UTSW 12 51784247 nonsense probably null
R4885:Hectd1 UTSW 12 51800722 missense probably damaging 0.97
R4975:Hectd1 UTSW 12 51762497 missense probably benign 0.02
R4983:Hectd1 UTSW 12 51784262 missense probably benign 0.01
R5007:Hectd1 UTSW 12 51802660 missense possibly damaging 0.95
R5046:Hectd1 UTSW 12 51750388 missense probably damaging 1.00
R5062:Hectd1 UTSW 12 51744879 missense probably damaging 0.98
R5164:Hectd1 UTSW 12 51827489 start codon destroyed probably null 0.60
R5213:Hectd1 UTSW 12 51802533 critical splice donor site probably null
R5535:Hectd1 UTSW 12 51802326 missense probably damaging 0.98
R5776:Hectd1 UTSW 12 51764114 missense possibly damaging 0.91
R5846:Hectd1 UTSW 12 51773835 missense probably damaging 0.99
R5907:Hectd1 UTSW 12 51798754 missense probably damaging 0.98
R5911:Hectd1 UTSW 12 51802252 missense probably damaging 0.99
R5919:Hectd1 UTSW 12 51769072 missense probably damaging 0.98
R6051:Hectd1 UTSW 12 51754104 missense probably benign
R6141:Hectd1 UTSW 12 51746092 critical splice donor site probably null
R6172:Hectd1 UTSW 12 51769282 missense probably damaging 1.00
R6194:Hectd1 UTSW 12 51748445 missense probably damaging 0.99
R6795:Hectd1 UTSW 12 51794487 missense possibly damaging 0.94
R6909:Hectd1 UTSW 12 51764162 splice site probably null
R6971:Hectd1 UTSW 12 51748743 nonsense probably null
R7079:Hectd1 UTSW 12 51787855 missense possibly damaging 0.96
R7104:Hectd1 UTSW 12 51827351 critical splice donor site probably null
R7171:Hectd1 UTSW 12 51759297 missense probably damaging 0.99
R7296:Hectd1 UTSW 12 51785852 missense possibly damaging 0.73
R7346:Hectd1 UTSW 12 51750321 missense probably benign
R7355:Hectd1 UTSW 12 51791298 missense possibly damaging 0.72
R7468:Hectd1 UTSW 12 51744805 synonymous probably null
R7531:Hectd1 UTSW 12 51806367 missense probably benign 0.33
R7532:Hectd1 UTSW 12 51790450 missense probably damaging 0.98
R7755:Hectd1 UTSW 12 51802220 missense possibly damaging 0.86
R7807:Hectd1 UTSW 12 51745388 missense probably damaging 1.00
R7842:Hectd1 UTSW 12 51772560 missense probably damaging 0.99
R7925:Hectd1 UTSW 12 51772560 missense probably damaging 0.99
R8059:Hectd1 UTSW 12 51790378 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- ATTCCACGTGTTCTCGAAGC -3'
(R):5'- ATCCGAGGCTCACAGTTGTAC -3'

Sequencing Primer
(F):5'- CACGTGTTCTCGAAGCCTTAATGG -3'
(R):5'- CGAGGCTCACAGTTGTACGAAAG -3'
Posted On2018-04-27