Incidental Mutation 'R6360:Cntnap5b'
ID513045
Institutional Source Beutler Lab
Gene Symbol Cntnap5b
Ensembl Gene ENSMUSG00000067028
Gene Namecontactin associated protein-like 5B
SynonymsCaspr5-2, C230078M14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R6360 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location99772765-100485942 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 100431736 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 695 (R695*)
Ref Sequence ENSEMBL: ENSMUSP00000139877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086738] [ENSMUST00000188735]
Predicted Effect probably null
Transcript: ENSMUST00000086738
AA Change: R1066*
SMART Domains Protein: ENSMUSP00000083944
Gene: ENSMUSG00000067028
AA Change: R1066*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
FA58C 39 174 2.76e-16 SMART
LamG 201 338 2.84e-27 SMART
LamG 387 521 9.22e-27 SMART
EGF 549 583 1.14e0 SMART
Blast:FBG 586 758 3e-66 BLAST
LamG 798 925 2.12e-26 SMART
EGF 946 982 1.51e0 SMART
LamG 1023 1159 2.14e-13 SMART
transmembrane domain 1227 1249 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000188735
AA Change: R695*
SMART Domains Protein: ENSMUSP00000139877
Gene: ENSMUSG00000067028
AA Change: R695*

DomainStartEndE-ValueType
LamG 73 207 5.9e-29 SMART
EGF 235 269 5.6e-3 SMART
Blast:FBG 272 402 2e-42 BLAST
LamG 415 554 2.5e-11 SMART
EGF 575 611 7.1e-3 SMART
LamG 652 788 1.4e-15 SMART
transmembrane domain 856 878 N/A INTRINSIC
Meta Mutation Damage Score 0.598 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap10 G A 8: 77,259,202 Q657* probably null Het
Car15 T C 16: 17,838,066 T560A probably benign Het
Cass4 C T 2: 172,432,611 H769Y probably damaging Het
Cdh6 A G 15: 13,041,460 I506T possibly damaging Het
Clstn3 G T 6: 124,438,429 R659S possibly damaging Het
Cpsf1 CCCCTGCATGAGGCAGGTCCC CCCC 15: 76,597,455 probably null Het
Dab2ip A G 2: 35,710,266 H355R probably benign Het
Dennd2a C T 6: 39,493,142 A539T probably benign Het
Dnajc18 T C 18: 35,686,709 E173G probably damaging Het
Dock7 T C 4: 98,969,662 I1472V probably benign Het
Esco1 A T 18: 10,574,931 F714I probably damaging Het
Fam107a T G 14: 8,299,619 H73P probably damaging Het
Fam46b T C 4: 133,486,756 F313L probably damaging Het
Flg A G 3: 93,290,601 probably benign Het
Fyn C A 10: 39,526,883 T217K possibly damaging Het
Gbp9 T C 5: 105,083,730 D330G probably benign Het
Gin1 T C 1: 97,792,539 S509P possibly damaging Het
Gm15922 A T 7: 3,736,504 L455Q probably damaging Het
Gm17067 A C 7: 42,708,482 S199A probably benign Het
Grk4 A T 5: 34,674,537 K50M probably damaging Het
Inpp4b A G 8: 81,902,852 H272R probably benign Het
Ipo7 T A 7: 110,027,129 L48Q probably damaging Het
Kbtbd2 A G 6: 56,779,206 I515T probably damaging Het
Kcnu1 T A 8: 25,861,180 S190R possibly damaging Het
Kpnb1 T C 11: 97,173,270 N336S probably benign Het
Lbr G T 1: 181,832,155 D158E probably benign Het
Mphosph10 T C 7: 64,389,955 Q89R probably benign Het
Nectin3 T A 16: 46,411,109 T21S probably benign Het
Numb C A 12: 83,797,262 R383L probably damaging Het
Olfr1370 A T 13: 21,072,583 N239K probably damaging Het
Olfr461 G T 6: 40,544,713 Q89K possibly damaging Het
Park2 T C 17: 12,004,052 F363S probably damaging Het
Pcdhb11 A T 18: 37,422,159 I181F probably benign Het
Pcgf2 T A 11: 97,692,409 probably null Het
Pdzd8 T C 19: 59,300,983 T662A probably benign Het
Pex13 A C 11: 23,655,690 V180G probably benign Het
Pkp4 T A 2: 59,214,747 V22D probably benign Het
Ppp1r32 T C 19: 10,479,481 N167D probably damaging Het
Prpf4b A C 13: 34,901,433 D954A probably damaging Het
Rfx8 T C 1: 39,680,965 I317V probably benign Het
Rnaseh2b T C 14: 62,361,419 S198P probably damaging Het
Rock1 A T 18: 10,116,778 C453S possibly damaging Het
Scarf1 G T 11: 75,515,669 G260W probably damaging Het
Scyl1 T C 19: 5,760,571 E538G probably damaging Het
Sec14l5 A T 16: 5,172,995 I267F probably damaging Het
Senp6 T A 9: 80,113,806 V256D probably benign Het
Sf3b4 G A 3: 96,176,728 probably benign Het
Ssh1 T C 5: 113,961,347 probably null Het
Tas2r143 A C 6: 42,400,835 M200L probably benign Het
Tbc1d22a C T 15: 86,214,629 P19S probably damaging Het
Tmc5 T A 7: 118,633,966 M1K probably null Het
Tnc T C 4: 64,000,733 Y1151C probably damaging Het
Tshz3 A G 7: 36,769,441 E285G probably damaging Het
Txndc11 C T 16: 11,084,792 V664M probably damaging Het
Ube2g1 A T 11: 72,663,082 N20Y probably damaging Het
Ufl1 T A 4: 25,265,476 I369L probably benign Het
Vwf A T 6: 125,683,526 T2666S probably benign Het
Yif1a A G 19: 5,092,341 M259V probably benign Het
Zbtb46 T C 2: 181,391,455 D471G probably damaging Het
Other mutations in Cntnap5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Cntnap5b APN 1 100050754 missense probably damaging 1.00
IGL00477:Cntnap5b APN 1 100213743 missense probably damaging 0.97
IGL00505:Cntnap5b APN 1 100379161 missense possibly damaging 0.81
IGL00596:Cntnap5b APN 1 100379161 missense possibly damaging 0.81
IGL00846:Cntnap5b APN 1 100164223 missense probably damaging 1.00
IGL00895:Cntnap5b APN 1 100383585 missense probably damaging 0.98
IGL00948:Cntnap5b APN 1 100141357 missense probably benign 0.00
IGL01073:Cntnap5b APN 1 100076030 missense probably benign 0.08
IGL01523:Cntnap5b APN 1 100431779 missense probably benign 0.02
IGL01779:Cntnap5b APN 1 99967339 missense probably damaging 1.00
IGL02253:Cntnap5b APN 1 100164211 missense possibly damaging 0.75
IGL02628:Cntnap5b APN 1 100072069 missense probably damaging 0.97
R0166:Cntnap5b UTSW 1 100274361 missense probably benign 0.41
R0211:Cntnap5b UTSW 1 100478374 missense possibly damaging 0.82
R0281:Cntnap5b UTSW 1 100072153 missense probably benign 0.22
R0363:Cntnap5b UTSW 1 100274468 missense probably benign 0.01
R0514:Cntnap5b UTSW 1 99772786 missense probably benign
R0645:Cntnap5b UTSW 1 100072042 splice site probably benign
R0848:Cntnap5b UTSW 1 100255163 missense probably benign 0.22
R1006:Cntnap5b UTSW 1 100383617 missense probably benign 0.00
R1349:Cntnap5b UTSW 1 100164088 missense probably benign 0.09
R1372:Cntnap5b UTSW 1 100164088 missense probably benign 0.09
R1474:Cntnap5b UTSW 1 100072089 missense probably benign 0.25
R1681:Cntnap5b UTSW 1 100076107 missense probably damaging 0.98
R1727:Cntnap5b UTSW 1 100213744 missense possibly damaging 0.91
R1760:Cntnap5b UTSW 1 99772810 missense probably benign 0.05
R1777:Cntnap5b UTSW 1 100370078 missense probably benign 0.10
R1939:Cntnap5b UTSW 1 99967348 missense probably benign
R1988:Cntnap5b UTSW 1 100072140 missense possibly damaging 0.92
R2069:Cntnap5b UTSW 1 100358725 missense probably benign 0.04
R2113:Cntnap5b UTSW 1 100274415 missense probably benign
R2148:Cntnap5b UTSW 1 100383474 missense probably benign 0.01
R2158:Cntnap5b UTSW 1 100390572 missense probably damaging 1.00
R2223:Cntnap5b UTSW 1 100213687 missense probably damaging 1.00
R2350:Cntnap5b UTSW 1 100379126 missense probably damaging 1.00
R3840:Cntnap5b UTSW 1 100383477 missense possibly damaging 0.50
R4329:Cntnap5b UTSW 1 100072163 missense probably damaging 0.99
R4609:Cntnap5b UTSW 1 99772847 critical splice donor site probably null
R4799:Cntnap5b UTSW 1 100358725 missense probably benign 0.04
R5129:Cntnap5b UTSW 1 100379090 missense probably damaging 1.00
R5323:Cntnap5b UTSW 1 100383550 nonsense probably null
R5434:Cntnap5b UTSW 1 100072201 missense probably benign 0.02
R5579:Cntnap5b UTSW 1 100383395 nonsense probably null
R5579:Cntnap5b UTSW 1 100383399 missense probably benign 0.27
R5630:Cntnap5b UTSW 1 100072069 missense probably damaging 0.99
R5644:Cntnap5b UTSW 1 100383601 missense probably benign 0.00
R5761:Cntnap5b UTSW 1 100446894 missense probably damaging 1.00
R6042:Cntnap5b UTSW 1 100390592 missense probably benign
R6147:Cntnap5b UTSW 1 100050781 missense probably damaging 1.00
R6190:Cntnap5b UTSW 1 100379075 missense possibly damaging 0.80
R6248:Cntnap5b UTSW 1 100072102 missense probably benign 0.30
R6286:Cntnap5b UTSW 1 100255073 missense possibly damaging 0.82
R6306:Cntnap5b UTSW 1 100164146 missense probably damaging 1.00
R6336:Cntnap5b UTSW 1 100358669 missense probably benign 0.00
R6722:Cntnap5b UTSW 1 100478486 missense probably damaging 0.98
R6750:Cntnap5b UTSW 1 100274499 missense probably damaging 1.00
R6806:Cntnap5b UTSW 1 99940649 missense probably damaging 1.00
R6933:Cntnap5b UTSW 1 100383450 missense probably benign 0.01
R6957:Cntnap5b UTSW 1 100274472 missense probably benign 0.08
R6958:Cntnap5b UTSW 1 100274472 missense probably benign 0.08
R6959:Cntnap5b UTSW 1 100274472 missense probably benign 0.08
R6961:Cntnap5b UTSW 1 100274472 missense probably benign 0.08
R6962:Cntnap5b UTSW 1 100274472 missense probably benign 0.08
R7088:Cntnap5b UTSW 1 100160077 missense probably damaging 0.99
R7146:Cntnap5b UTSW 1 100050794 splice site probably null
R7165:Cntnap5b UTSW 1 100076162 missense possibly damaging 0.94
R7190:Cntnap5b UTSW 1 100431849 splice site probably null
R7376:Cntnap5b UTSW 1 99967269 missense possibly damaging 0.92
R7385:Cntnap5b UTSW 1 100379090 missense probably damaging 1.00
X0020:Cntnap5b UTSW 1 100431848 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGACTACACCATTGCACTCTTC -3'
(R):5'- ATAAGGAGGATCATTGCAGTATGTG -3'

Sequencing Primer
(F):5'- ACACCATTGCACTCTTCTTAAACTAG -3'
(R):5'- GTGGAGCTCAGATATGTTAGATAAAG -3'
Posted On2018-04-27