Incidental Mutation 'R6360:Cass4'
ID513049
Institutional Source Beutler Lab
Gene Symbol Cass4
Ensembl Gene ENSMUSG00000074570
Gene NameCas scaffolding protein family member 4
SynonymsF730031O20Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_001033538.2, NM_001080820.1; MGI:2444482

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6360 (G1)
Quality Score212.009
Status Validated
Chromosome2
Chromosomal Location172393794-172433757 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 172432611 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 769 (H769Y)
Ref Sequence ENSEMBL: ENSMUSP00000099362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099061] [ENSMUST00000103073] [ENSMUST00000109136] [ENSMUST00000228775]
Predicted Effect probably benign
Transcript: ENSMUST00000099061
SMART Domains Protein: ENSMUSP00000096660
Gene: ENSMUSG00000074570

DomainStartEndE-ValueType
SH3 14 72 5.65e-16 SMART
low complexity region 392 428 N/A INTRINSIC
Pfam:Serine_rich 433 591 4.2e-68 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103073
AA Change: H769Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099362
Gene: ENSMUSG00000074570
AA Change: H769Y

DomainStartEndE-ValueType
SH3 14 72 5.65e-16 SMART
low complexity region 392 428 N/A INTRINSIC
Pfam:Serine_rich 433 591 7.5e-69 PFAM
Pfam:DUF3513 587 778 8.8e-60 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109136
AA Change: H795Y

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104764
Gene: ENSMUSG00000074570
AA Change: H795Y

DomainStartEndE-ValueType
SH3 14 72 5.65e-16 SMART
low complexity region 392 428 N/A INTRINSIC
Pfam:Serine_rich 433 589 3.8e-58 PFAM
Pfam:DUF3513 593 803 1.6e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138288
Predicted Effect probably benign
Transcript: ENSMUST00000228775
AA Change: H771Y

PolyPhen 2 Score 0.376 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 98% (59/60)
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap10 G A 8: 77,259,202 Q657* probably null Het
Car15 T C 16: 17,838,066 T560A probably benign Het
Cdh6 A G 15: 13,041,460 I506T possibly damaging Het
Clstn3 G T 6: 124,438,429 R659S possibly damaging Het
Cntnap5b C T 1: 100,431,736 R695* probably null Het
Cpsf1 CCCCTGCATGAGGCAGGTCCC CCCC 15: 76,597,455 probably null Het
Dab2ip A G 2: 35,710,266 H355R probably benign Het
Dennd2a C T 6: 39,493,142 A539T probably benign Het
Dnajc18 T C 18: 35,686,709 E173G probably damaging Het
Dock7 T C 4: 98,969,662 I1472V probably benign Het
Esco1 A T 18: 10,574,931 F714I probably damaging Het
Fam107a T G 14: 8,299,619 H73P probably damaging Het
Fam46b T C 4: 133,486,756 F313L probably damaging Het
Flg A G 3: 93,290,601 probably benign Het
Fyn C A 10: 39,526,883 T217K possibly damaging Het
Gbp9 T C 5: 105,083,730 D330G probably benign Het
Gin1 T C 1: 97,792,539 S509P possibly damaging Het
Gm15922 A T 7: 3,736,504 L455Q probably damaging Het
Gm17067 A C 7: 42,708,482 S199A probably benign Het
Grk4 A T 5: 34,674,537 K50M probably damaging Het
Inpp4b A G 8: 81,902,852 H272R probably benign Het
Ipo7 T A 7: 110,027,129 L48Q probably damaging Het
Kbtbd2 A G 6: 56,779,206 I515T probably damaging Het
Kcnu1 T A 8: 25,861,180 S190R possibly damaging Het
Kpnb1 T C 11: 97,173,270 N336S probably benign Het
Lbr G T 1: 181,832,155 D158E probably benign Het
Mphosph10 T C 7: 64,389,955 Q89R probably benign Het
Nectin3 T A 16: 46,411,109 T21S probably benign Het
Numb C A 12: 83,797,262 R383L probably damaging Het
Olfr1370 A T 13: 21,072,583 N239K probably damaging Het
Olfr461 G T 6: 40,544,713 Q89K possibly damaging Het
Park2 T C 17: 12,004,052 F363S probably damaging Het
Pcdhb11 A T 18: 37,422,159 I181F probably benign Het
Pcgf2 T A 11: 97,692,409 probably null Het
Pdzd8 T C 19: 59,300,983 T662A probably benign Het
Pex13 A C 11: 23,655,690 V180G probably benign Het
Pkp4 T A 2: 59,214,747 V22D probably benign Het
Ppp1r32 T C 19: 10,479,481 N167D probably damaging Het
Prpf4b A C 13: 34,901,433 D954A probably damaging Het
Rfx8 T C 1: 39,680,965 I317V probably benign Het
Rnaseh2b T C 14: 62,361,419 S198P probably damaging Het
Rock1 A T 18: 10,116,778 C453S possibly damaging Het
Scarf1 G T 11: 75,515,669 G260W probably damaging Het
Scyl1 T C 19: 5,760,571 E538G probably damaging Het
Sec14l5 A T 16: 5,172,995 I267F probably damaging Het
Senp6 T A 9: 80,113,806 V256D probably benign Het
Sf3b4 G A 3: 96,176,728 probably benign Het
Ssh1 T C 5: 113,961,347 probably null Het
Tas2r143 A C 6: 42,400,835 M200L probably benign Het
Tbc1d22a C T 15: 86,214,629 P19S probably damaging Het
Tmc5 T A 7: 118,633,966 M1K probably null Het
Tnc T C 4: 64,000,733 Y1151C probably damaging Het
Tshz3 A G 7: 36,769,441 E285G probably damaging Het
Txndc11 C T 16: 11,084,792 V664M probably damaging Het
Ube2g1 A T 11: 72,663,082 N20Y probably damaging Het
Ufl1 T A 4: 25,265,476 I369L probably benign Het
Vwf A T 6: 125,683,526 T2666S probably benign Het
Yif1a A G 19: 5,092,341 M259V probably benign Het
Zbtb46 T C 2: 181,391,455 D471G probably damaging Het
Other mutations in Cass4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Cass4 APN 2 172416250 missense probably damaging 1.00
IGL00846:Cass4 APN 2 172429723 intron probably benign
IGL01400:Cass4 APN 2 172427300 missense probably damaging 1.00
IGL01985:Cass4 APN 2 172427206 missense probably damaging 1.00
IGL02268:Cass4 APN 2 172427042 missense possibly damaging 0.76
IGL02592:Cass4 APN 2 172416328 missense probably benign 0.00
R0030:Cass4 UTSW 2 172427842 nonsense probably null
R0035:Cass4 UTSW 2 172416492 missense probably damaging 1.00
R0039:Cass4 UTSW 2 172426980 missense probably damaging 1.00
R0631:Cass4 UTSW 2 172432411 missense probably damaging 1.00
R1321:Cass4 UTSW 2 172424652 missense probably benign 0.05
R1352:Cass4 UTSW 2 172416495 missense probably damaging 0.98
R1612:Cass4 UTSW 2 172427078 missense possibly damaging 0.46
R1720:Cass4 UTSW 2 172427734 missense probably damaging 0.99
R1776:Cass4 UTSW 2 172427695 missense probably benign
R1918:Cass4 UTSW 2 172427339 missense possibly damaging 0.69
R2257:Cass4 UTSW 2 172427470 missense probably damaging 1.00
R2257:Cass4 UTSW 2 172432558 missense probably damaging 1.00
R2262:Cass4 UTSW 2 172427254 missense probably damaging 1.00
R2924:Cass4 UTSW 2 172426672 missense possibly damaging 0.89
R3498:Cass4 UTSW 2 172432558 missense probably damaging 1.00
R3499:Cass4 UTSW 2 172432558 missense probably damaging 1.00
R3792:Cass4 UTSW 2 172432558 missense probably damaging 1.00
R3793:Cass4 UTSW 2 172432558 missense probably damaging 1.00
R3901:Cass4 UTSW 2 172432558 missense probably damaging 1.00
R4899:Cass4 UTSW 2 172427869 missense probably benign
R5161:Cass4 UTSW 2 172432324 missense probably damaging 1.00
R5534:Cass4 UTSW 2 172426768 missense probably benign 0.13
R5646:Cass4 UTSW 2 172416245 missense probably damaging 1.00
R5799:Cass4 UTSW 2 172416187 missense probably damaging 1.00
R5873:Cass4 UTSW 2 172426768 missense probably benign 0.13
R6084:Cass4 UTSW 2 172426912 missense probably benign 0.01
R6432:Cass4 UTSW 2 172427719 missense probably damaging 1.00
R7116:Cass4 UTSW 2 172427969 missense unknown
R7212:Cass4 UTSW 2 172427186 nonsense probably null
R7549:Cass4 UTSW 2 172426798 missense probably benign 0.01
R7549:Cass4 UTSW 2 172426799 missense probably benign 0.00
R7594:Cass4 UTSW 2 172429648 missense probably benign 0.03
R7659:Cass4 UTSW 2 172427027 missense probably damaging 1.00
R8003:Cass4 UTSW 2 172427959 missense unknown
Z1177:Cass4 UTSW 2 172427575 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTGGACAGAAGCTGGTGGAC -3'
(R):5'- TCTCAAGGTCTTGACTTGTCG -3'

Sequencing Primer
(F):5'- ACACGCTGTGCAGTGAGAC -3'
(R):5'- AGGTCTTGACTTGTCGCCTGC -3'
Posted On2018-04-27