Incidental Mutation 'R6360:Zbtb46'
ID 513050
Institutional Source Beutler Lab
Gene Symbol Zbtb46
Ensembl Gene ENSMUSG00000027583
Gene Name zinc finger and BTB domain containing 46
Synonyms 2610019F01Rik, Btbd4, 4933406L05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.214) question?
Stock # R6360 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 181387762-181459426 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 181391455 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 471 (D471G)
Ref Sequence ENSEMBL: ENSMUSP00000137014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029106] [ENSMUST00000180222]
AlphaFold Q8BID6
Predicted Effect probably damaging
Transcript: ENSMUST00000029106
AA Change: D471G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000029106
Gene: ENSMUSG00000027583
AA Change: D471G

BTB 31 129 2.89e-21 SMART
ZnF_C2H2 418 440 4.72e-2 SMART
ZnF_C2H2 446 468 4.24e-4 SMART
ZnF_C2H2 474 498 1.31e2 SMART
low complexity region 543 557 N/A INTRINSIC
low complexity region 568 580 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127559
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176590
Predicted Effect probably damaging
Transcript: ENSMUST00000180222
AA Change: D471G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000137014
Gene: ENSMUSG00000027583
AA Change: D471G

BTB 31 129 2.89e-21 SMART
ZnF_C2H2 418 440 4.72e-2 SMART
ZnF_C2H2 446 468 4.24e-4 SMART
ZnF_C2H2 474 498 1.31e2 SMART
low complexity region 543 557 N/A INTRINSIC
low complexity region 568 580 N/A INTRINSIC
Meta Mutation Damage Score 0.3154 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 98% (59/60)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit repressed altered myeloid potential in dendritic cells. Mice homozygous for a different knock-out allele exhibit partial activation of classical dendritic cells in the steady state. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap10 G A 8: 77,259,202 Q657* probably null Het
Car15 T C 16: 17,838,066 T560A probably benign Het
Cass4 C T 2: 172,432,611 H769Y probably damaging Het
Cdh6 A G 15: 13,041,460 I506T possibly damaging Het
Clstn3 G T 6: 124,438,429 R659S possibly damaging Het
Cntnap5b C T 1: 100,431,736 R695* probably null Het
Cpsf1 CCCCTGCATGAGGCAGGTCCC CCCC 15: 76,597,455 probably null Het
Dab2ip A G 2: 35,710,266 H355R probably benign Het
Dennd2a C T 6: 39,493,142 A539T probably benign Het
Dnajc18 T C 18: 35,686,709 E173G probably damaging Het
Dock7 T C 4: 98,969,662 I1472V probably benign Het
Esco1 A T 18: 10,574,931 F714I probably damaging Het
Fam107a T G 14: 8,299,619 H73P probably damaging Het
Fam46b T C 4: 133,486,756 F313L probably damaging Het
Flg A G 3: 93,290,601 probably benign Het
Fyn C A 10: 39,526,883 T217K possibly damaging Het
Gbp9 T C 5: 105,083,730 D330G probably benign Het
Gin1 T C 1: 97,792,539 S509P possibly damaging Het
Gm15922 A T 7: 3,736,504 L455Q probably damaging Het
Gm17067 A C 7: 42,708,482 S199A probably benign Het
Grk4 A T 5: 34,674,537 K50M probably damaging Het
Inpp4b A G 8: 81,902,852 H272R probably benign Het
Ipo7 T A 7: 110,027,129 L48Q probably damaging Het
Kbtbd2 A G 6: 56,779,206 I515T probably damaging Het
Kcnu1 T A 8: 25,861,180 S190R possibly damaging Het
Kpnb1 T C 11: 97,173,270 N336S probably benign Het
Lbr G T 1: 181,832,155 D158E probably benign Het
Mphosph10 T C 7: 64,389,955 Q89R probably benign Het
Nectin3 T A 16: 46,411,109 T21S probably benign Het
Numb C A 12: 83,797,262 R383L probably damaging Het
Olfr1370 A T 13: 21,072,583 N239K probably damaging Het
Olfr461 G T 6: 40,544,713 Q89K possibly damaging Het
Park2 T C 17: 12,004,052 F363S probably damaging Het
Pcdhb11 A T 18: 37,422,159 I181F probably benign Het
Pcgf2 T A 11: 97,692,409 probably null Het
Pdzd8 T C 19: 59,300,983 T662A probably benign Het
Pex13 A C 11: 23,655,690 V180G probably benign Het
Pkp4 T A 2: 59,214,747 V22D probably benign Het
Ppp1r32 T C 19: 10,479,481 N167D probably damaging Het
Prpf4b A C 13: 34,901,433 D954A probably damaging Het
Rfx8 T C 1: 39,680,965 I317V probably benign Het
Rnaseh2b T C 14: 62,361,419 S198P probably damaging Het
Rock1 A T 18: 10,116,778 C453S possibly damaging Het
Scarf1 G T 11: 75,515,669 G260W probably damaging Het
Scyl1 T C 19: 5,760,571 E538G probably damaging Het
Sec14l5 A T 16: 5,172,995 I267F probably damaging Het
Senp6 T A 9: 80,113,806 V256D probably benign Het
Sf3b4 G A 3: 96,176,728 probably benign Het
Ssh1 T C 5: 113,961,347 probably null Het
Tas2r143 A C 6: 42,400,835 M200L probably benign Het
Tbc1d22a C T 15: 86,214,629 P19S probably damaging Het
Tmc5 T A 7: 118,633,966 M1K probably null Het
Tnc T C 4: 64,000,733 Y1151C probably damaging Het
Tshz3 A G 7: 36,769,441 E285G probably damaging Het
Txndc11 C T 16: 11,084,792 V664M probably damaging Het
Ube2g1 A T 11: 72,663,082 N20Y probably damaging Het
Ufl1 T A 4: 25,265,476 I369L probably benign Het
Vwf A T 6: 125,683,526 T2666S probably benign Het
Yif1a A G 19: 5,092,341 M259V probably benign Het
Other mutations in Zbtb46
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01960:Zbtb46 APN 2 181424135 missense possibly damaging 0.48
IGL02401:Zbtb46 APN 2 181423452 missense probably benign 0.01
R0127:Zbtb46 UTSW 2 181411815 missense probably benign 0.32
R0279:Zbtb46 UTSW 2 181411774 missense possibly damaging 0.67
R1618:Zbtb46 UTSW 2 181424249 missense possibly damaging 0.92
R1711:Zbtb46 UTSW 2 181411684 missense probably damaging 1.00
R1785:Zbtb46 UTSW 2 181391431 missense probably damaging 1.00
R1786:Zbtb46 UTSW 2 181391431 missense probably damaging 1.00
R1906:Zbtb46 UTSW 2 181423839 missense probably damaging 1.00
R4170:Zbtb46 UTSW 2 181424355 start codon destroyed probably null 0.98
R4782:Zbtb46 UTSW 2 181391136 missense probably benign
R5656:Zbtb46 UTSW 2 181423417 critical splice donor site probably null
R5808:Zbtb46 UTSW 2 181423570 missense probably benign 0.00
R5932:Zbtb46 UTSW 2 181411920 missense probably benign 0.00
R6467:Zbtb46 UTSW 2 181391269 missense probably damaging 1.00
R6672:Zbtb46 UTSW 2 181411836 missense probably benign 0.01
R6960:Zbtb46 UTSW 2 181423424 missense probably damaging 0.99
R7485:Zbtb46 UTSW 2 181423719 missense probably benign 0.04
R7780:Zbtb46 UTSW 2 181391432 missense probably damaging 1.00
R9023:Zbtb46 UTSW 2 181424142 missense possibly damaging 0.64
R9091:Zbtb46 UTSW 2 181424345 missense probably benign 0.04
R9270:Zbtb46 UTSW 2 181424345 missense probably benign 0.04
R9450:Zbtb46 UTSW 2 181395488 missense probably damaging 1.00
R9573:Zbtb46 UTSW 2 181411755 missense probably benign 0.03
Z1177:Zbtb46 UTSW 2 181424044 missense possibly damaging 0.74
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2018-04-27