Incidental Mutation 'R6360:Ufl1'
ID513053
Institutional Source Beutler Lab
Gene Symbol Ufl1
Ensembl Gene ENSMUSG00000040359
Gene NameUFM1 specific ligase 1
Synonyms1810074P20Rik, Maxer, Rcad
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.877) question?
Stock #R6360 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location25248600-25281821 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 25265476 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 369 (I369L)
Ref Sequence ENSEMBL: ENSMUSP00000100059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038705] [ENSMUST00000102994]
Predicted Effect probably benign
Transcript: ENSMUST00000038705
AA Change: I289L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000042118
Gene: ENSMUSG00000040359
AA Change: I289L

DomainStartEndE-ValueType
Pfam:DUF2042 2 205 1.5e-70 PFAM
low complexity region 334 344 N/A INTRINSIC
low complexity region 348 358 N/A INTRINSIC
low complexity region 364 374 N/A INTRINSIC
low complexity region 375 385 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102994
AA Change: I369L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000100059
Gene: ENSMUSG00000040359
AA Change: I369L

DomainStartEndE-ValueType
Pfam:DUF2042 7 284 4.8e-117 PFAM
low complexity region 414 424 N/A INTRINSIC
low complexity region 428 438 N/A INTRINSIC
low complexity region 444 454 N/A INTRINSIC
low complexity region 455 465 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124792
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132558
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142949
Meta Mutation Damage Score 0.0689 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 98% (59/60)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality during organogensis, anemia and decreased erythroid progenitor cell number. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap10 G A 8: 77,259,202 Q657* probably null Het
Car15 T C 16: 17,838,066 T560A probably benign Het
Cass4 C T 2: 172,432,611 H769Y probably damaging Het
Cdh6 A G 15: 13,041,460 I506T possibly damaging Het
Clstn3 G T 6: 124,438,429 R659S possibly damaging Het
Cntnap5b C T 1: 100,431,736 R695* probably null Het
Cpsf1 CCCCTGCATGAGGCAGGTCCC CCCC 15: 76,597,455 probably null Het
Dab2ip A G 2: 35,710,266 H355R probably benign Het
Dennd2a C T 6: 39,493,142 A539T probably benign Het
Dnajc18 T C 18: 35,686,709 E173G probably damaging Het
Dock7 T C 4: 98,969,662 I1472V probably benign Het
Esco1 A T 18: 10,574,931 F714I probably damaging Het
Fam107a T G 14: 8,299,619 H73P probably damaging Het
Fam46b T C 4: 133,486,756 F313L probably damaging Het
Flg A G 3: 93,290,601 probably benign Het
Fyn C A 10: 39,526,883 T217K possibly damaging Het
Gbp9 T C 5: 105,083,730 D330G probably benign Het
Gin1 T C 1: 97,792,539 S509P possibly damaging Het
Gm15922 A T 7: 3,736,504 L455Q probably damaging Het
Gm17067 A C 7: 42,708,482 S199A probably benign Het
Grk4 A T 5: 34,674,537 K50M probably damaging Het
Inpp4b A G 8: 81,902,852 H272R probably benign Het
Ipo7 T A 7: 110,027,129 L48Q probably damaging Het
Kbtbd2 A G 6: 56,779,206 I515T probably damaging Het
Kcnu1 T A 8: 25,861,180 S190R possibly damaging Het
Kpnb1 T C 11: 97,173,270 N336S probably benign Het
Lbr G T 1: 181,832,155 D158E probably benign Het
Mphosph10 T C 7: 64,389,955 Q89R probably benign Het
Nectin3 T A 16: 46,411,109 T21S probably benign Het
Numb C A 12: 83,797,262 R383L probably damaging Het
Olfr1370 A T 13: 21,072,583 N239K probably damaging Het
Olfr461 G T 6: 40,544,713 Q89K possibly damaging Het
Park2 T C 17: 12,004,052 F363S probably damaging Het
Pcdhb11 A T 18: 37,422,159 I181F probably benign Het
Pcgf2 T A 11: 97,692,409 probably null Het
Pdzd8 T C 19: 59,300,983 T662A probably benign Het
Pex13 A C 11: 23,655,690 V180G probably benign Het
Pkp4 T A 2: 59,214,747 V22D probably benign Het
Ppp1r32 T C 19: 10,479,481 N167D probably damaging Het
Prpf4b A C 13: 34,901,433 D954A probably damaging Het
Rfx8 T C 1: 39,680,965 I317V probably benign Het
Rnaseh2b T C 14: 62,361,419 S198P probably damaging Het
Rock1 A T 18: 10,116,778 C453S possibly damaging Het
Scarf1 G T 11: 75,515,669 G260W probably damaging Het
Scyl1 T C 19: 5,760,571 E538G probably damaging Het
Sec14l5 A T 16: 5,172,995 I267F probably damaging Het
Senp6 T A 9: 80,113,806 V256D probably benign Het
Sf3b4 G A 3: 96,176,728 probably benign Het
Ssh1 T C 5: 113,961,347 probably null Het
Tas2r143 A C 6: 42,400,835 M200L probably benign Het
Tbc1d22a C T 15: 86,214,629 P19S probably damaging Het
Tmc5 T A 7: 118,633,966 M1K probably null Het
Tnc T C 4: 64,000,733 Y1151C probably damaging Het
Tshz3 A G 7: 36,769,441 E285G probably damaging Het
Txndc11 C T 16: 11,084,792 V664M probably damaging Het
Ube2g1 A T 11: 72,663,082 N20Y probably damaging Het
Vwf A T 6: 125,683,526 T2666S probably benign Het
Yif1a A G 19: 5,092,341 M259V probably benign Het
Zbtb46 T C 2: 181,391,455 D471G probably damaging Het
Other mutations in Ufl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00703:Ufl1 APN 4 25280631 missense possibly damaging 0.67
IGL00899:Ufl1 APN 4 25262238 missense probably damaging 1.00
IGL00928:Ufl1 APN 4 25267790 missense probably damaging 1.00
IGL00949:Ufl1 APN 4 25275822 missense probably damaging 0.99
IGL02179:Ufl1 APN 4 25254896 missense probably damaging 0.99
IGL02228:Ufl1 APN 4 25281686 missense probably benign
IGL02237:Ufl1 APN 4 25269082 missense probably benign 0.01
IGL02294:Ufl1 APN 4 25259281 nonsense probably null
IGL02331:Ufl1 APN 4 25251971 missense probably damaging 1.00
IGL02374:Ufl1 APN 4 25259237 missense probably benign 0.01
IGL02541:Ufl1 APN 4 25250534 missense possibly damaging 0.56
IGL03053:Ufl1 APN 4 25275833 missense probably damaging 0.99
R0054:Ufl1 UTSW 4 25269087 missense probably damaging 0.96
R0054:Ufl1 UTSW 4 25269087 missense probably damaging 0.96
R0164:Ufl1 UTSW 4 25256008 missense probably benign 0.00
R0164:Ufl1 UTSW 4 25256008 missense probably benign 0.00
R0172:Ufl1 UTSW 4 25280685 missense probably benign 0.32
R2069:Ufl1 UTSW 4 25269036 missense possibly damaging 0.75
R4320:Ufl1 UTSW 4 25278601 splice site probably null
R4467:Ufl1 UTSW 4 25254806 missense probably damaging 1.00
R4993:Ufl1 UTSW 4 25267832 missense possibly damaging 0.70
R5049:Ufl1 UTSW 4 25254773 missense probably benign 0.17
R5071:Ufl1 UTSW 4 25254780 missense probably benign
R5072:Ufl1 UTSW 4 25254780 missense probably benign
R5073:Ufl1 UTSW 4 25254780 missense probably benign
R5099:Ufl1 UTSW 4 25275914 missense probably damaging 0.99
R5108:Ufl1 UTSW 4 25269026 critical splice donor site probably null
R5127:Ufl1 UTSW 4 25256010 missense probably benign 0.05
R5262:Ufl1 UTSW 4 25251294 intron probably benign
R5409:Ufl1 UTSW 4 25280706 missense probably damaging 1.00
R5942:Ufl1 UTSW 4 25250619 missense probably benign
R6031:Ufl1 UTSW 4 25278038 missense probably benign 0.09
R6031:Ufl1 UTSW 4 25278038 missense probably benign 0.09
R6107:Ufl1 UTSW 4 25251999 missense possibly damaging 0.88
R6157:Ufl1 UTSW 4 25279350 missense possibly damaging 0.83
R6296:Ufl1 UTSW 4 25270572 missense probably benign
R6514:Ufl1 UTSW 4 25262238 missense probably damaging 1.00
R6754:Ufl1 UTSW 4 25267796 nonsense probably null
R6755:Ufl1 UTSW 4 25262316 missense probably damaging 0.96
R7196:Ufl1 UTSW 4 25250669 missense probably benign 0.05
R7247:Ufl1 UTSW 4 25254637 missense probably damaging 1.00
R7287:Ufl1 UTSW 4 25254852 missense probably benign 0.04
R7755:Ufl1 UTSW 4 25262274 missense probably benign
RF037:Ufl1 UTSW 4 25280628 missense possibly damaging 0.67
RF039:Ufl1 UTSW 4 25280628 missense possibly damaging 0.67
V7732:Ufl1 UTSW 4 25251368 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGGATCAAAGCCTTTGGTAACTTC -3'
(R):5'- CTGGCTTCAACGAGGATATATGAG -3'

Sequencing Primer
(F):5'- CAAAGCCTTTGGTAACTTCATTTG -3'
(R):5'- AAACATATAACCCCTGTTTCCCTG -3'
Posted On2018-04-27