Incidental Mutation 'R6360:Gbp9'
ID513058
Institutional Source Beutler Lab
Gene Symbol Gbp9
Ensembl Gene ENSMUSG00000029298
Gene Nameguanylate-binding protein 9
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R6360 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location105077630-105139539 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105083730 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 330 (D330G)
Ref Sequence ENSEMBL: ENSMUSP00000098521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031235] [ENSMUST00000031238] [ENSMUST00000100961]
Predicted Effect probably benign
Transcript: ENSMUST00000031235
SMART Domains Protein: ENSMUSP00000031235
Gene: ENSMUSG00000034438

DomainStartEndE-ValueType
Pfam:GBP 16 213 5.4e-91 PFAM
Pfam:GBP_C 206 493 1e-115 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000031238
AA Change: D330G

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000031238
Gene: ENSMUSG00000029298
AA Change: D330G

DomainStartEndE-ValueType
Pfam:GBP 16 279 1.2e-117 PFAM
Pfam:GBP_C 281 575 4.5e-115 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100961
AA Change: D330G

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000098521
Gene: ENSMUSG00000029298
AA Change: D330G

DomainStartEndE-ValueType
Pfam:GBP 16 279 3.8e-124 PFAM
Pfam:GBP_C 281 575 4.5e-115 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196820
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199453
Meta Mutation Damage Score 0.4393 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap10 G A 8: 77,259,202 Q657* probably null Het
Car15 T C 16: 17,838,066 T560A probably benign Het
Cass4 C T 2: 172,432,611 H769Y probably damaging Het
Cdh6 A G 15: 13,041,460 I506T possibly damaging Het
Clstn3 G T 6: 124,438,429 R659S possibly damaging Het
Cntnap5b C T 1: 100,431,736 R695* probably null Het
Cpsf1 CCCCTGCATGAGGCAGGTCCC CCCC 15: 76,597,455 probably null Het
Dab2ip A G 2: 35,710,266 H355R probably benign Het
Dennd2a C T 6: 39,493,142 A539T probably benign Het
Dnajc18 T C 18: 35,686,709 E173G probably damaging Het
Dock7 T C 4: 98,969,662 I1472V probably benign Het
Esco1 A T 18: 10,574,931 F714I probably damaging Het
Fam107a T G 14: 8,299,619 H73P probably damaging Het
Fam46b T C 4: 133,486,756 F313L probably damaging Het
Flg A G 3: 93,290,601 probably benign Het
Fyn C A 10: 39,526,883 T217K possibly damaging Het
Gin1 T C 1: 97,792,539 S509P possibly damaging Het
Gm15922 A T 7: 3,736,504 L455Q probably damaging Het
Gm17067 A C 7: 42,708,482 S199A probably benign Het
Grk4 A T 5: 34,674,537 K50M probably damaging Het
Inpp4b A G 8: 81,902,852 H272R probably benign Het
Ipo7 T A 7: 110,027,129 L48Q probably damaging Het
Kbtbd2 A G 6: 56,779,206 I515T probably damaging Het
Kcnu1 T A 8: 25,861,180 S190R possibly damaging Het
Kpnb1 T C 11: 97,173,270 N336S probably benign Het
Lbr G T 1: 181,832,155 D158E probably benign Het
Mphosph10 T C 7: 64,389,955 Q89R probably benign Het
Nectin3 T A 16: 46,411,109 T21S probably benign Het
Numb C A 12: 83,797,262 R383L probably damaging Het
Olfr1370 A T 13: 21,072,583 N239K probably damaging Het
Olfr461 G T 6: 40,544,713 Q89K possibly damaging Het
Park2 T C 17: 12,004,052 F363S probably damaging Het
Pcdhb11 A T 18: 37,422,159 I181F probably benign Het
Pcgf2 T A 11: 97,692,409 probably null Het
Pdzd8 T C 19: 59,300,983 T662A probably benign Het
Pex13 A C 11: 23,655,690 V180G probably benign Het
Pkp4 T A 2: 59,214,747 V22D probably benign Het
Ppp1r32 T C 19: 10,479,481 N167D probably damaging Het
Prpf4b A C 13: 34,901,433 D954A probably damaging Het
Rfx8 T C 1: 39,680,965 I317V probably benign Het
Rnaseh2b T C 14: 62,361,419 S198P probably damaging Het
Rock1 A T 18: 10,116,778 C453S possibly damaging Het
Scarf1 G T 11: 75,515,669 G260W probably damaging Het
Scyl1 T C 19: 5,760,571 E538G probably damaging Het
Sec14l5 A T 16: 5,172,995 I267F probably damaging Het
Senp6 T A 9: 80,113,806 V256D probably benign Het
Sf3b4 G A 3: 96,176,728 probably benign Het
Ssh1 T C 5: 113,961,347 probably null Het
Tas2r143 A C 6: 42,400,835 M200L probably benign Het
Tbc1d22a C T 15: 86,214,629 P19S probably damaging Het
Tmc5 T A 7: 118,633,966 M1K probably null Het
Tnc T C 4: 64,000,733 Y1151C probably damaging Het
Tshz3 A G 7: 36,769,441 E285G probably damaging Het
Txndc11 C T 16: 11,084,792 V664M probably damaging Het
Ube2g1 A T 11: 72,663,082 N20Y probably damaging Het
Ufl1 T A 4: 25,265,476 I369L probably benign Het
Vwf A T 6: 125,683,526 T2666S probably benign Het
Yif1a A G 19: 5,092,341 M259V probably benign Het
Zbtb46 T C 2: 181,391,455 D471G probably damaging Het
Other mutations in Gbp9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Gbp9 APN 5 105081264 missense probably benign 0.01
IGL00419:Gbp9 APN 5 105094077 missense probably benign 0.05
IGL00425:Gbp9 APN 5 105105754 missense possibly damaging 0.82
IGL00597:Gbp9 APN 5 105094498 missense probably damaging 1.00
IGL01362:Gbp9 APN 5 105080206 missense probably damaging 1.00
IGL01679:Gbp9 APN 5 105085172 splice site probably null
IGL01803:Gbp9 APN 5 105094173 missense probably damaging 1.00
IGL01803:Gbp9 APN 5 105085018 missense probably damaging 0.99
IGL02054:Gbp9 APN 5 105082807 missense probably benign 0.12
IGL02474:Gbp9 APN 5 105094567 splice site probably benign
IGL02633:Gbp9 APN 5 105083565 splice site probably benign
IGL02666:Gbp9 APN 5 105094275 splice site probably null
IGL02689:Gbp9 APN 5 105105796 missense probably benign 0.11
IGL02812:Gbp9 APN 5 105083758 missense probably damaging 1.00
IGL03132:Gbp9 APN 5 105084953 missense possibly damaging 0.83
IGL03274:Gbp9 APN 5 105082786 missense possibly damaging 0.58
R0410:Gbp9 UTSW 5 105085073 missense probably benign 0.17
R1018:Gbp9 UTSW 5 105080260 missense probably benign 0.15
R1479:Gbp9 UTSW 5 105094064 splice site probably benign
R1655:Gbp9 UTSW 5 105081692 missense possibly damaging 0.76
R1658:Gbp9 UTSW 5 105094468 missense probably damaging 0.98
R1757:Gbp9 UTSW 5 105094453 missense probably damaging 1.00
R1950:Gbp9 UTSW 5 105081246 missense probably benign 0.01
R1986:Gbp9 UTSW 5 105105724 missense probably damaging 1.00
R1986:Gbp9 UTSW 5 105105786 missense probably damaging 0.98
R2124:Gbp9 UTSW 5 105094543 missense probably damaging 1.00
R2302:Gbp9 UTSW 5 105094092 missense possibly damaging 0.47
R2378:Gbp9 UTSW 5 105080176 missense probably benign 0.02
R2997:Gbp9 UTSW 5 105082769 missense probably benign 0.00
R3745:Gbp9 UTSW 5 105105858 start gained probably benign
R4182:Gbp9 UTSW 5 105083595 missense probably benign 0.08
R4485:Gbp9 UTSW 5 105083808 missense probably damaging 0.97
R4718:Gbp9 UTSW 5 105083758 missense probably damaging 1.00
R5063:Gbp9 UTSW 5 105085162 missense probably benign
R5099:Gbp9 UTSW 5 105094513 missense probably damaging 1.00
R5104:Gbp9 UTSW 5 105080141 missense probably benign 0.00
R5199:Gbp9 UTSW 5 105083812 missense probably benign 0.04
R5712:Gbp9 UTSW 5 105094555 missense possibly damaging 0.80
R5751:Gbp9 UTSW 5 105081258 missense probably benign 0.06
R5895:Gbp9 UTSW 5 105082858 missense probably damaging 1.00
R6646:Gbp9 UTSW 5 105082903 missense probably benign 0.13
R7559:Gbp9 UTSW 5 105085109 missense probably damaging 1.00
R7819:Gbp9 UTSW 5 105103879 missense possibly damaging 0.65
R8042:Gbp9 UTSW 5 105094242 missense probably damaging 1.00
R8288:Gbp9 UTSW 5 105105733 missense probably damaging 1.00
R8303:Gbp9 UTSW 5 105081305 missense possibly damaging 0.94
R8354:Gbp9 UTSW 5 105094161 missense probably damaging 0.97
R8395:Gbp9 UTSW 5 105080203 missense probably damaging 1.00
R8397:Gbp9 UTSW 5 105083598 missense possibly damaging 0.94
R8751:Gbp9 UTSW 5 105081251 missense possibly damaging 0.49
R8808:Gbp9 UTSW 5 105085009 missense probably damaging 1.00
Z1088:Gbp9 UTSW 5 105094125 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCGCCATGACAGTTAATGC -3'
(R):5'- ACTTGCTGAAGAAGATTGTTGG -3'

Sequencing Primer
(F):5'- ATGACAGTTAATGCCATCAACAG -3'
(R):5'- GTTGTGTGGTTCCCATTCATTATAAC -3'
Posted On2018-04-27