Incidental Mutation 'R6360:Gbp9'
ID 513058
Institutional Source Beutler Lab
Gene Symbol Gbp9
Ensembl Gene ENSMUSG00000029298
Gene Name guanylate-binding protein 9
Synonyms
MMRRC Submission 044510-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.055) question?
Stock # R6360 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 105224332-105258255 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 105231596 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 330 (D330G)
Ref Sequence ENSEMBL: ENSMUSP00000098521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031235] [ENSMUST00000031238] [ENSMUST00000100961]
AlphaFold Q8BTS3
Predicted Effect probably benign
Transcript: ENSMUST00000031235
SMART Domains Protein: ENSMUSP00000031235
Gene: ENSMUSG00000034438

DomainStartEndE-ValueType
Pfam:GBP 16 213 5.4e-91 PFAM
Pfam:GBP_C 206 493 1e-115 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000031238
AA Change: D330G

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000031238
Gene: ENSMUSG00000029298
AA Change: D330G

DomainStartEndE-ValueType
Pfam:GBP 16 279 1.2e-117 PFAM
Pfam:GBP_C 281 575 4.5e-115 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100961
AA Change: D330G

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000098521
Gene: ENSMUSG00000029298
AA Change: D330G

DomainStartEndE-ValueType
Pfam:GBP 16 279 3.8e-124 PFAM
Pfam:GBP_C 281 575 4.5e-115 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196820
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199453
Meta Mutation Damage Score 0.4393 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap10 G A 8: 77,985,831 (GRCm39) Q657* probably null Het
Car15 T C 16: 17,655,930 (GRCm39) T560A probably benign Het
Cass4 C T 2: 172,274,531 (GRCm39) H769Y probably damaging Het
Cdh6 A G 15: 13,041,546 (GRCm39) I506T possibly damaging Het
Clstn3 G T 6: 124,415,388 (GRCm39) R659S possibly damaging Het
Cntnap5b C T 1: 100,359,461 (GRCm39) R695* probably null Het
Cpsf1 CCCCTGCATGAGGCAGGTCCC CCCC 15: 76,481,655 (GRCm39) probably null Het
Dab2ip A G 2: 35,600,278 (GRCm39) H355R probably benign Het
Dennd2a C T 6: 39,470,076 (GRCm39) A539T probably benign Het
Dnajc18 T C 18: 35,819,762 (GRCm39) E173G probably damaging Het
Dock7 T C 4: 98,857,899 (GRCm39) I1472V probably benign Het
Esco1 A T 18: 10,574,931 (GRCm39) F714I probably damaging Het
Fam107a T G 14: 8,299,619 (GRCm38) H73P probably damaging Het
Flg A G 3: 93,197,908 (GRCm39) probably benign Het
Fyn C A 10: 39,402,879 (GRCm39) T217K possibly damaging Het
Gin1 T C 1: 97,720,264 (GRCm39) S509P possibly damaging Het
Gm17067 A C 7: 42,357,906 (GRCm39) S199A probably benign Het
Grk4 A T 5: 34,831,881 (GRCm39) K50M probably damaging Het
Inpp4b A G 8: 82,629,481 (GRCm39) H272R probably benign Het
Ipo7 T A 7: 109,626,336 (GRCm39) L48Q probably damaging Het
Kbtbd2 A G 6: 56,756,191 (GRCm39) I515T probably damaging Het
Kcnu1 T A 8: 26,351,208 (GRCm39) S190R possibly damaging Het
Kpnb1 T C 11: 97,064,096 (GRCm39) N336S probably benign Het
Lbr G T 1: 181,659,720 (GRCm39) D158E probably benign Het
Mphosph10 T C 7: 64,039,703 (GRCm39) Q89R probably benign Het
Nectin3 T A 16: 46,231,472 (GRCm39) T21S probably benign Het
Numb C A 12: 83,844,036 (GRCm39) R383L probably damaging Het
Or2p2 A T 13: 21,256,753 (GRCm39) N239K probably damaging Het
Or9a7 G T 6: 40,521,647 (GRCm39) Q89K possibly damaging Het
Pcdhb11 A T 18: 37,555,212 (GRCm39) I181F probably benign Het
Pcgf2 T A 11: 97,583,235 (GRCm39) probably null Het
Pdzd8 T C 19: 59,289,415 (GRCm39) T662A probably benign Het
Pex13 A C 11: 23,605,690 (GRCm39) V180G probably benign Het
Pira1 A T 7: 3,739,503 (GRCm39) L455Q probably damaging Het
Pkp4 T A 2: 59,045,091 (GRCm39) V22D probably benign Het
Prkn T C 17: 12,222,939 (GRCm39) F363S probably damaging Het
Prpf4b A C 13: 35,085,416 (GRCm39) D954A probably damaging Het
Rfx8 T C 1: 39,720,125 (GRCm39) I317V probably benign Het
Rnaseh2b T C 14: 62,598,868 (GRCm39) S198P probably damaging Het
Rock1 A T 18: 10,116,778 (GRCm39) C453S possibly damaging Het
Saxo4 T C 19: 10,456,845 (GRCm39) N167D probably damaging Het
Scarf1 G T 11: 75,406,495 (GRCm39) G260W probably damaging Het
Scyl1 T C 19: 5,810,599 (GRCm39) E538G probably damaging Het
Sec14l5 A T 16: 4,990,859 (GRCm39) I267F probably damaging Het
Senp6 T A 9: 80,021,088 (GRCm39) V256D probably benign Het
Sf3b4 G A 3: 96,084,044 (GRCm39) probably benign Het
Ssh1 T C 5: 114,099,408 (GRCm39) probably null Het
Tas2r143 A C 6: 42,377,769 (GRCm39) M200L probably benign Het
Tbc1d22a C T 15: 86,098,830 (GRCm39) P19S probably damaging Het
Tent5b T C 4: 133,214,067 (GRCm39) F313L probably damaging Het
Tmc5 T A 7: 118,233,189 (GRCm39) M1K probably null Het
Tnc T C 4: 63,918,970 (GRCm39) Y1151C probably damaging Het
Tshz3 A G 7: 36,468,866 (GRCm39) E285G probably damaging Het
Txndc11 C T 16: 10,902,656 (GRCm39) V664M probably damaging Het
Ube2g1 A T 11: 72,553,908 (GRCm39) N20Y probably damaging Het
Ufl1 T A 4: 25,265,476 (GRCm39) I369L probably benign Het
Vwf A T 6: 125,660,489 (GRCm39) T2666S probably benign Het
Yif1a A G 19: 5,142,369 (GRCm39) M259V probably benign Het
Zbtb46 T C 2: 181,033,248 (GRCm39) D471G probably damaging Het
Other mutations in Gbp9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Gbp9 APN 5 105,229,130 (GRCm39) missense probably benign 0.01
IGL00419:Gbp9 APN 5 105,241,943 (GRCm39) missense probably benign 0.05
IGL00425:Gbp9 APN 5 105,253,620 (GRCm39) missense possibly damaging 0.82
IGL00597:Gbp9 APN 5 105,242,364 (GRCm39) missense probably damaging 1.00
IGL01362:Gbp9 APN 5 105,228,072 (GRCm39) missense probably damaging 1.00
IGL01679:Gbp9 APN 5 105,233,038 (GRCm39) splice site probably null
IGL01803:Gbp9 APN 5 105,232,884 (GRCm39) missense probably damaging 0.99
IGL01803:Gbp9 APN 5 105,242,039 (GRCm39) missense probably damaging 1.00
IGL02054:Gbp9 APN 5 105,230,673 (GRCm39) missense probably benign 0.12
IGL02474:Gbp9 APN 5 105,242,433 (GRCm39) splice site probably benign
IGL02633:Gbp9 APN 5 105,231,431 (GRCm39) splice site probably benign
IGL02666:Gbp9 APN 5 105,242,141 (GRCm39) splice site probably null
IGL02689:Gbp9 APN 5 105,253,662 (GRCm39) missense probably benign 0.11
IGL02812:Gbp9 APN 5 105,231,624 (GRCm39) missense probably damaging 1.00
IGL03132:Gbp9 APN 5 105,232,819 (GRCm39) missense possibly damaging 0.83
IGL03274:Gbp9 APN 5 105,230,652 (GRCm39) missense possibly damaging 0.58
R0410:Gbp9 UTSW 5 105,232,939 (GRCm39) missense probably benign 0.17
R1018:Gbp9 UTSW 5 105,228,126 (GRCm39) missense probably benign 0.15
R1479:Gbp9 UTSW 5 105,241,930 (GRCm39) splice site probably benign
R1655:Gbp9 UTSW 5 105,229,558 (GRCm39) missense possibly damaging 0.76
R1658:Gbp9 UTSW 5 105,242,334 (GRCm39) missense probably damaging 0.98
R1757:Gbp9 UTSW 5 105,242,319 (GRCm39) missense probably damaging 1.00
R1950:Gbp9 UTSW 5 105,229,112 (GRCm39) missense probably benign 0.01
R1986:Gbp9 UTSW 5 105,253,652 (GRCm39) missense probably damaging 0.98
R1986:Gbp9 UTSW 5 105,253,590 (GRCm39) missense probably damaging 1.00
R2124:Gbp9 UTSW 5 105,242,409 (GRCm39) missense probably damaging 1.00
R2302:Gbp9 UTSW 5 105,241,958 (GRCm39) missense possibly damaging 0.47
R2378:Gbp9 UTSW 5 105,228,042 (GRCm39) missense probably benign 0.02
R2997:Gbp9 UTSW 5 105,230,635 (GRCm39) missense probably benign 0.00
R3745:Gbp9 UTSW 5 105,253,724 (GRCm39) start gained probably benign
R4182:Gbp9 UTSW 5 105,231,461 (GRCm39) missense probably benign 0.08
R4485:Gbp9 UTSW 5 105,231,674 (GRCm39) missense probably damaging 0.97
R4718:Gbp9 UTSW 5 105,231,624 (GRCm39) missense probably damaging 1.00
R5063:Gbp9 UTSW 5 105,233,028 (GRCm39) missense probably benign
R5099:Gbp9 UTSW 5 105,242,379 (GRCm39) missense probably damaging 1.00
R5104:Gbp9 UTSW 5 105,228,007 (GRCm39) missense probably benign 0.00
R5199:Gbp9 UTSW 5 105,231,678 (GRCm39) missense probably benign 0.04
R5712:Gbp9 UTSW 5 105,242,421 (GRCm39) missense possibly damaging 0.80
R5751:Gbp9 UTSW 5 105,229,124 (GRCm39) missense probably benign 0.06
R5895:Gbp9 UTSW 5 105,230,724 (GRCm39) missense probably damaging 1.00
R6646:Gbp9 UTSW 5 105,230,769 (GRCm39) missense probably benign 0.13
R7559:Gbp9 UTSW 5 105,232,975 (GRCm39) missense probably damaging 1.00
R7819:Gbp9 UTSW 5 105,251,745 (GRCm39) missense possibly damaging 0.65
R8042:Gbp9 UTSW 5 105,242,108 (GRCm39) missense probably damaging 1.00
R8288:Gbp9 UTSW 5 105,253,599 (GRCm39) missense probably damaging 1.00
R8303:Gbp9 UTSW 5 105,229,171 (GRCm39) missense possibly damaging 0.94
R8354:Gbp9 UTSW 5 105,242,027 (GRCm39) missense probably damaging 0.97
R8395:Gbp9 UTSW 5 105,228,069 (GRCm39) missense probably damaging 1.00
R8397:Gbp9 UTSW 5 105,231,464 (GRCm39) missense possibly damaging 0.94
R8751:Gbp9 UTSW 5 105,229,117 (GRCm39) missense possibly damaging 0.49
R8808:Gbp9 UTSW 5 105,232,875 (GRCm39) missense probably damaging 1.00
R9105:Gbp9 UTSW 5 105,241,942 (GRCm39) missense probably benign 0.11
R9116:Gbp9 UTSW 5 105,231,695 (GRCm39) missense
R9354:Gbp9 UTSW 5 105,232,825 (GRCm39) missense possibly damaging 0.79
R9513:Gbp9 UTSW 5 105,229,091 (GRCm39) missense probably benign 0.06
R9709:Gbp9 UTSW 5 105,231,542 (GRCm39) missense probably damaging 0.99
R9717:Gbp9 UTSW 5 105,253,587 (GRCm39) nonsense probably null
Z1088:Gbp9 UTSW 5 105,241,991 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCGCCATGACAGTTAATGC -3'
(R):5'- ACTTGCTGAAGAAGATTGTTGG -3'

Sequencing Primer
(F):5'- ATGACAGTTAATGCCATCAACAG -3'
(R):5'- GTTGTGTGGTTCCCATTCATTATAAC -3'
Posted On 2018-04-27