Incidental Mutation 'R6360:Ssh1'
Institutional Source Beutler Lab
Gene Symbol Ssh1
Ensembl Gene ENSMUSG00000042121
Gene Nameslingshot protein phosphatase 1
SynonymsmSSH-1L, LOC384311
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6360 (G1)
Quality Score186.009
Status Validated
Chromosomal Location113937094-113993894 bp(-) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) T to C at 113961347 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077689] [ENSMUST00000112298] [ENSMUST00000159510] [ENSMUST00000159592] [ENSMUST00000162396]
Predicted Effect probably null
Transcript: ENSMUST00000077689
SMART Domains Protein: ENSMUSP00000076873
Gene: ENSMUSG00000042121

Pfam:DEK_C 208 261 1.1e-19 PFAM
DSPc 265 403 7.82e-47 SMART
low complexity region 490 503 N/A INTRINSIC
low complexity region 654 669 N/A INTRINSIC
low complexity region 686 704 N/A INTRINSIC
low complexity region 732 748 N/A INTRINSIC
low complexity region 874 892 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112298
SMART Domains Protein: ENSMUSP00000107917
Gene: ENSMUSG00000042121

low complexity region 13 22 N/A INTRINSIC
Pfam:DEK_C 229 282 9.5e-20 PFAM
DSPc 286 424 7.82e-47 SMART
low complexity region 511 524 N/A INTRINSIC
low complexity region 675 690 N/A INTRINSIC
low complexity region 707 725 N/A INTRINSIC
low complexity region 753 769 N/A INTRINSIC
low complexity region 895 913 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159510
Predicted Effect probably null
Transcript: ENSMUST00000159592
SMART Domains Protein: ENSMUSP00000124312
Gene: ENSMUSG00000042121

low complexity region 13 22 N/A INTRINSIC
Pfam:DEK_C 252 303 2.3e-17 PFAM
DSPc 308 446 7.82e-47 SMART
low complexity region 533 546 N/A INTRINSIC
low complexity region 697 712 N/A INTRINSIC
low complexity region 729 747 N/A INTRINSIC
low complexity region 775 791 N/A INTRINSIC
low complexity region 917 935 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162396
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the slingshot homolog (SSH) family of phosphatases, which regulate actin filament dynamics. The SSH proteins dephosphorylate and activate the actin binding/depolymerizing factor cofilin, which subsequently binds to actin filaments and stimulates their disassembly. Cofilin is inactivated by kinases such as LIM domain kinase-1 (LIMK1), which may also be dephosphorylated and inactivated by SSH proteins. The SSH family thus appears to play a role in actin dynamics by reactivating cofilin proteins. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap10 G A 8: 77,259,202 Q657* probably null Het
Car15 T C 16: 17,838,066 T560A probably benign Het
Cass4 C T 2: 172,432,611 H769Y probably damaging Het
Cdh6 A G 15: 13,041,460 I506T possibly damaging Het
Clstn3 G T 6: 124,438,429 R659S possibly damaging Het
Cntnap5b C T 1: 100,431,736 R695* probably null Het
Cpsf1 CCCCTGCATGAGGCAGGTCCC CCCC 15: 76,597,455 probably null Het
Dab2ip A G 2: 35,710,266 H355R probably benign Het
Dennd2a C T 6: 39,493,142 A539T probably benign Het
Dnajc18 T C 18: 35,686,709 E173G probably damaging Het
Dock7 T C 4: 98,969,662 I1472V probably benign Het
Esco1 A T 18: 10,574,931 F714I probably damaging Het
Fam107a T G 14: 8,299,619 H73P probably damaging Het
Fam46b T C 4: 133,486,756 F313L probably damaging Het
Flg A G 3: 93,290,601 probably benign Het
Fyn C A 10: 39,526,883 T217K possibly damaging Het
Gbp9 T C 5: 105,083,730 D330G probably benign Het
Gin1 T C 1: 97,792,539 S509P possibly damaging Het
Gm15922 A T 7: 3,736,504 L455Q probably damaging Het
Gm17067 A C 7: 42,708,482 S199A probably benign Het
Grk4 A T 5: 34,674,537 K50M probably damaging Het
Inpp4b A G 8: 81,902,852 H272R probably benign Het
Ipo7 T A 7: 110,027,129 L48Q probably damaging Het
Kbtbd2 A G 6: 56,779,206 I515T probably damaging Het
Kcnu1 T A 8: 25,861,180 S190R possibly damaging Het
Kpnb1 T C 11: 97,173,270 N336S probably benign Het
Lbr G T 1: 181,832,155 D158E probably benign Het
Mphosph10 T C 7: 64,389,955 Q89R probably benign Het
Nectin3 T A 16: 46,411,109 T21S probably benign Het
Numb C A 12: 83,797,262 R383L probably damaging Het
Olfr1370 A T 13: 21,072,583 N239K probably damaging Het
Olfr461 G T 6: 40,544,713 Q89K possibly damaging Het
Park2 T C 17: 12,004,052 F363S probably damaging Het
Pcdhb11 A T 18: 37,422,159 I181F probably benign Het
Pcgf2 T A 11: 97,692,409 probably null Het
Pdzd8 T C 19: 59,300,983 T662A probably benign Het
Pex13 A C 11: 23,655,690 V180G probably benign Het
Pkp4 T A 2: 59,214,747 V22D probably benign Het
Ppp1r32 T C 19: 10,479,481 N167D probably damaging Het
Prpf4b A C 13: 34,901,433 D954A probably damaging Het
Rfx8 T C 1: 39,680,965 I317V probably benign Het
Rnaseh2b T C 14: 62,361,419 S198P probably damaging Het
Rock1 A T 18: 10,116,778 C453S possibly damaging Het
Scarf1 G T 11: 75,515,669 G260W probably damaging Het
Scyl1 T C 19: 5,760,571 E538G probably damaging Het
Sec14l5 A T 16: 5,172,995 I267F probably damaging Het
Senp6 T A 9: 80,113,806 V256D probably benign Het
Sf3b4 G A 3: 96,176,728 probably benign Het
Tas2r143 A C 6: 42,400,835 M200L probably benign Het
Tbc1d22a C T 15: 86,214,629 P19S probably damaging Het
Tmc5 T A 7: 118,633,966 M1K probably null Het
Tnc T C 4: 64,000,733 Y1151C probably damaging Het
Tshz3 A G 7: 36,769,441 E285G probably damaging Het
Txndc11 C T 16: 11,084,792 V664M probably damaging Het
Ube2g1 A T 11: 72,663,082 N20Y probably damaging Het
Ufl1 T A 4: 25,265,476 I369L probably benign Het
Vwf A T 6: 125,683,526 T2666S probably benign Het
Yif1a A G 19: 5,092,341 M259V probably benign Het
Zbtb46 T C 2: 181,391,455 D471G probably damaging Het
Other mutations in Ssh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Ssh1 APN 5 113942576 missense probably damaging 1.00
IGL01432:Ssh1 APN 5 113958822 missense probably benign 0.31
IGL01933:Ssh1 APN 5 113950380 splice site probably benign
IGL01951:Ssh1 APN 5 113966247 missense possibly damaging 0.64
IGL02117:Ssh1 APN 5 113946480 nonsense probably null
IGL02391:Ssh1 APN 5 113942517 missense probably damaging 1.00
R0110:Ssh1 UTSW 5 113946705 missense probably benign 0.00
R0469:Ssh1 UTSW 5 113946705 missense probably benign 0.00
R0510:Ssh1 UTSW 5 113946705 missense probably benign 0.00
R0682:Ssh1 UTSW 5 113960657 missense probably damaging 1.00
R0863:Ssh1 UTSW 5 113966731 missense probably damaging 1.00
R0939:Ssh1 UTSW 5 113970436 missense probably damaging 1.00
R1539:Ssh1 UTSW 5 113952003 missense probably damaging 1.00
R1716:Ssh1 UTSW 5 113952020 missense possibly damaging 0.80
R1754:Ssh1 UTSW 5 113955845 missense probably damaging 0.99
R1867:Ssh1 UTSW 5 113943451 missense probably damaging 1.00
R2261:Ssh1 UTSW 5 113942703 missense possibly damaging 0.94
R2262:Ssh1 UTSW 5 113942703 missense possibly damaging 0.94
R2497:Ssh1 UTSW 5 113958858 missense probably damaging 1.00
R3774:Ssh1 UTSW 5 113966722 missense probably damaging 1.00
R3922:Ssh1 UTSW 5 113942708 missense possibly damaging 0.52
R5120:Ssh1 UTSW 5 113957398 missense possibly damaging 0.89
R5283:Ssh1 UTSW 5 113950545 missense probably damaging 1.00
R5810:Ssh1 UTSW 5 113946566 missense probably benign 0.05
R5877:Ssh1 UTSW 5 113943120 missense probably benign 0.29
R6140:Ssh1 UTSW 5 113942631 missense probably benign 0.16
R6612:Ssh1 UTSW 5 113958730 missense probably benign 0.43
R6819:Ssh1 UTSW 5 113946790 missense probably benign
R6855:Ssh1 UTSW 5 113942575 missense probably damaging 1.00
R7389:Ssh1 UTSW 5 113958831 missense probably benign 0.28
R7470:Ssh1 UTSW 5 113942427 missense possibly damaging 0.63
R7568:Ssh1 UTSW 5 113957380 splice site probably null
R7647:Ssh1 UTSW 5 113942958 missense probably benign 0.00
R7649:Ssh1 UTSW 5 113950551 missense probably benign 0.12
R7754:Ssh1 UTSW 5 113966234 missense probably benign 0.31
R7887:Ssh1 UTSW 5 113961349 critical splice donor site probably null
R8167:Ssh1 UTSW 5 113951990 missense possibly damaging 0.49
R8289:Ssh1 UTSW 5 113942384 missense probably benign 0.01
Z1177:Ssh1 UTSW 5 113966294 missense possibly damaging 0.92
Predicted Primers PCR Primer

Sequencing Primer
Posted On2018-04-27