Incidental Mutation 'R6360:Dennd2a'
Institutional Source Beutler Lab
Gene Symbol Dennd2a
Ensembl Gene ENSMUSG00000038456
Gene NameDENN/MADD domain containing 2A
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock #R6360 (G1)
Quality Score190.009
Status Validated
Chromosomal Location39462378-39557867 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 39493142 bp
Amino Acid Change Alanine to Threonine at position 539 (A539T)
Ref Sequence ENSEMBL: ENSMUSP00000045367 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036877] [ENSMUST00000154149]
Predicted Effect probably benign
Transcript: ENSMUST00000036877
AA Change: A539T

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000045367
Gene: ENSMUSG00000038456
AA Change: A539T

Blast:DENN 9 430 1e-149 BLAST
low complexity region 445 457 N/A INTRINSIC
low complexity region 508 520 N/A INTRINSIC
uDENN 554 646 2.06e-31 SMART
DENN 653 837 7.1e-76 SMART
dDENN 888 953 1.84e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149162
Predicted Effect probably benign
Transcript: ENSMUST00000154149
SMART Domains Protein: ENSMUSP00000116907
Gene: ENSMUSG00000038456

Blast:DENN 9 420 1e-152 BLAST
Meta Mutation Damage Score 0.0612 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap10 G A 8: 77,259,202 Q657* probably null Het
Car15 T C 16: 17,838,066 T560A probably benign Het
Cass4 C T 2: 172,432,611 H769Y probably damaging Het
Cdh6 A G 15: 13,041,460 I506T possibly damaging Het
Clstn3 G T 6: 124,438,429 R659S possibly damaging Het
Cntnap5b C T 1: 100,431,736 R695* probably null Het
Cpsf1 CCCCTGCATGAGGCAGGTCCC CCCC 15: 76,597,455 probably null Het
Dab2ip A G 2: 35,710,266 H355R probably benign Het
Dnajc18 T C 18: 35,686,709 E173G probably damaging Het
Dock7 T C 4: 98,969,662 I1472V probably benign Het
Esco1 A T 18: 10,574,931 F714I probably damaging Het
Fam107a T G 14: 8,299,619 H73P probably damaging Het
Fam46b T C 4: 133,486,756 F313L probably damaging Het
Flg A G 3: 93,290,601 probably benign Het
Fyn C A 10: 39,526,883 T217K possibly damaging Het
Gbp9 T C 5: 105,083,730 D330G probably benign Het
Gin1 T C 1: 97,792,539 S509P possibly damaging Het
Gm15922 A T 7: 3,736,504 L455Q probably damaging Het
Gm17067 A C 7: 42,708,482 S199A probably benign Het
Grk4 A T 5: 34,674,537 K50M probably damaging Het
Inpp4b A G 8: 81,902,852 H272R probably benign Het
Ipo7 T A 7: 110,027,129 L48Q probably damaging Het
Kbtbd2 A G 6: 56,779,206 I515T probably damaging Het
Kcnu1 T A 8: 25,861,180 S190R possibly damaging Het
Kpnb1 T C 11: 97,173,270 N336S probably benign Het
Lbr G T 1: 181,832,155 D158E probably benign Het
Mphosph10 T C 7: 64,389,955 Q89R probably benign Het
Nectin3 T A 16: 46,411,109 T21S probably benign Het
Numb C A 12: 83,797,262 R383L probably damaging Het
Olfr1370 A T 13: 21,072,583 N239K probably damaging Het
Olfr461 G T 6: 40,544,713 Q89K possibly damaging Het
Park2 T C 17: 12,004,052 F363S probably damaging Het
Pcdhb11 A T 18: 37,422,159 I181F probably benign Het
Pcgf2 T A 11: 97,692,409 probably null Het
Pdzd8 T C 19: 59,300,983 T662A probably benign Het
Pex13 A C 11: 23,655,690 V180G probably benign Het
Pkp4 T A 2: 59,214,747 V22D probably benign Het
Ppp1r32 T C 19: 10,479,481 N167D probably damaging Het
Prpf4b A C 13: 34,901,433 D954A probably damaging Het
Rfx8 T C 1: 39,680,965 I317V probably benign Het
Rnaseh2b T C 14: 62,361,419 S198P probably damaging Het
Rock1 A T 18: 10,116,778 C453S possibly damaging Het
Scarf1 G T 11: 75,515,669 G260W probably damaging Het
Scyl1 T C 19: 5,760,571 E538G probably damaging Het
Sec14l5 A T 16: 5,172,995 I267F probably damaging Het
Senp6 T A 9: 80,113,806 V256D probably benign Het
Sf3b4 G A 3: 96,176,728 probably benign Het
Ssh1 T C 5: 113,961,347 probably null Het
Tas2r143 A C 6: 42,400,835 M200L probably benign Het
Tbc1d22a C T 15: 86,214,629 P19S probably damaging Het
Tmc5 T A 7: 118,633,966 M1K probably null Het
Tnc T C 4: 64,000,733 Y1151C probably damaging Het
Tshz3 A G 7: 36,769,441 E285G probably damaging Het
Txndc11 C T 16: 11,084,792 V664M probably damaging Het
Ube2g1 A T 11: 72,663,082 N20Y probably damaging Het
Ufl1 T A 4: 25,265,476 I369L probably benign Het
Vwf A T 6: 125,683,526 T2666S probably benign Het
Yif1a A G 19: 5,092,341 M259V probably benign Het
Zbtb46 T C 2: 181,391,455 D471G probably damaging Het
Other mutations in Dennd2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01385:Dennd2a APN 6 39523136 missense probably damaging 1.00
IGL01482:Dennd2a APN 6 39480309 missense probably damaging 0.98
IGL02135:Dennd2a APN 6 39480271 nonsense probably null
IGL02206:Dennd2a APN 6 39523449 missense probably damaging 1.00
IGL02649:Dennd2a APN 6 39470356 missense probably benign 0.11
IGL03057:Dennd2a APN 6 39508248 missense probably damaging 0.98
R0310:Dennd2a UTSW 6 39464201 splice site probably benign
R0326:Dennd2a UTSW 6 39497110 missense probably damaging 1.00
R0360:Dennd2a UTSW 6 39508299 missense probably benign 0.13
R0364:Dennd2a UTSW 6 39508299 missense probably benign 0.13
R0394:Dennd2a UTSW 6 39522812 missense possibly damaging 0.92
R0680:Dennd2a UTSW 6 39483062 missense probably damaging 1.00
R1741:Dennd2a UTSW 6 39493157 missense probably damaging 0.99
R1744:Dennd2a UTSW 6 39480251 missense probably benign 0.26
R2070:Dennd2a UTSW 6 39465119 missense probably damaging 1.00
R3833:Dennd2a UTSW 6 39506717 missense probably damaging 0.97
R3833:Dennd2a UTSW 6 39506723 missense probably damaging 0.98
R4120:Dennd2a UTSW 6 39465096 missense probably damaging 0.99
R4583:Dennd2a UTSW 6 39522842 missense probably damaging 1.00
R4842:Dennd2a UTSW 6 39497110 missense probably damaging 1.00
R4887:Dennd2a UTSW 6 39497159 missense probably benign 0.03
R4901:Dennd2a UTSW 6 39522687 missense probably benign 0.00
R5065:Dennd2a UTSW 6 39495176 critical splice donor site probably null
R5413:Dennd2a UTSW 6 39464293 missense probably damaging 1.00
R6181:Dennd2a UTSW 6 39485620 missense probably benign 0.14
R6239:Dennd2a UTSW 6 39488816 missense probably damaging 1.00
R7115:Dennd2a UTSW 6 39506711 missense probably damaging 1.00
R7419:Dennd2a UTSW 6 39523463 missense probably damaging 1.00
R7567:Dennd2a UTSW 6 39522809 missense probably benign
R7587:Dennd2a UTSW 6 39483135 missense probably damaging 1.00
R7662:Dennd2a UTSW 6 39493103 missense probably benign 0.03
R7781:Dennd2a UTSW 6 39493066 missense probably damaging 0.99
R7962:Dennd2a UTSW 6 39480273 missense possibly damaging 0.91
R8683:Dennd2a UTSW 6 39523203 nonsense probably null
R8961:Dennd2a UTSW 6 39485621 missense probably damaging 0.96
X0026:Dennd2a UTSW 6 39508367 missense possibly damaging 0.61
Z1177:Dennd2a UTSW 6 39523474 missense probably benign 0.38
Predicted Primers PCR Primer

Sequencing Primer
Posted On2018-04-27