Incidental Mutation 'R6360:Olfr461'
ID 513061
Institutional Source Beutler Lab
Gene Symbol Olfr461
Ensembl Gene ENSMUSG00000068259
Gene Name olfactory receptor 461
Synonyms MOR120-3, GA_x6K02T2P3E9-6973252-6974193
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock # R6360 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 40542171-40555050 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 40544713 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 89 (Q89K)
Ref Sequence ENSEMBL: ENSMUSP00000150632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089490] [ENSMUST00000215009]
AlphaFold Q8VF30
Predicted Effect possibly damaging
Transcript: ENSMUST00000089490
AA Change: Q89K

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000086917
Gene: ENSMUSG00000068259
AA Change: Q89K

Pfam:7tm_4 30 306 2e-41 PFAM
Pfam:7tm_1 40 289 1.3e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215009
AA Change: Q89K

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216766
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap10 G A 8: 77,259,202 Q657* probably null Het
Car15 T C 16: 17,838,066 T560A probably benign Het
Cass4 C T 2: 172,432,611 H769Y probably damaging Het
Cdh6 A G 15: 13,041,460 I506T possibly damaging Het
Clstn3 G T 6: 124,438,429 R659S possibly damaging Het
Cntnap5b C T 1: 100,431,736 R695* probably null Het
Cpsf1 CCCCTGCATGAGGCAGGTCCC CCCC 15: 76,597,455 probably null Het
Dab2ip A G 2: 35,710,266 H355R probably benign Het
Dennd2a C T 6: 39,493,142 A539T probably benign Het
Dnajc18 T C 18: 35,686,709 E173G probably damaging Het
Dock7 T C 4: 98,969,662 I1472V probably benign Het
Esco1 A T 18: 10,574,931 F714I probably damaging Het
Fam107a T G 14: 8,299,619 H73P probably damaging Het
Fam46b T C 4: 133,486,756 F313L probably damaging Het
Flg A G 3: 93,290,601 probably benign Het
Fyn C A 10: 39,526,883 T217K possibly damaging Het
Gbp9 T C 5: 105,083,730 D330G probably benign Het
Gin1 T C 1: 97,792,539 S509P possibly damaging Het
Gm15922 A T 7: 3,736,504 L455Q probably damaging Het
Gm17067 A C 7: 42,708,482 S199A probably benign Het
Grk4 A T 5: 34,674,537 K50M probably damaging Het
Inpp4b A G 8: 81,902,852 H272R probably benign Het
Ipo7 T A 7: 110,027,129 L48Q probably damaging Het
Kbtbd2 A G 6: 56,779,206 I515T probably damaging Het
Kcnu1 T A 8: 25,861,180 S190R possibly damaging Het
Kpnb1 T C 11: 97,173,270 N336S probably benign Het
Lbr G T 1: 181,832,155 D158E probably benign Het
Mphosph10 T C 7: 64,389,955 Q89R probably benign Het
Nectin3 T A 16: 46,411,109 T21S probably benign Het
Numb C A 12: 83,797,262 R383L probably damaging Het
Olfr1370 A T 13: 21,072,583 N239K probably damaging Het
Park2 T C 17: 12,004,052 F363S probably damaging Het
Pcdhb11 A T 18: 37,422,159 I181F probably benign Het
Pcgf2 T A 11: 97,692,409 probably null Het
Pdzd8 T C 19: 59,300,983 T662A probably benign Het
Pex13 A C 11: 23,655,690 V180G probably benign Het
Pkp4 T A 2: 59,214,747 V22D probably benign Het
Ppp1r32 T C 19: 10,479,481 N167D probably damaging Het
Prpf4b A C 13: 34,901,433 D954A probably damaging Het
Rfx8 T C 1: 39,680,965 I317V probably benign Het
Rnaseh2b T C 14: 62,361,419 S198P probably damaging Het
Rock1 A T 18: 10,116,778 C453S possibly damaging Het
Scarf1 G T 11: 75,515,669 G260W probably damaging Het
Scyl1 T C 19: 5,760,571 E538G probably damaging Het
Sec14l5 A T 16: 5,172,995 I267F probably damaging Het
Senp6 T A 9: 80,113,806 V256D probably benign Het
Sf3b4 G A 3: 96,176,728 probably benign Het
Ssh1 T C 5: 113,961,347 probably null Het
Tas2r143 A C 6: 42,400,835 M200L probably benign Het
Tbc1d22a C T 15: 86,214,629 P19S probably damaging Het
Tmc5 T A 7: 118,633,966 M1K probably null Het
Tnc T C 4: 64,000,733 Y1151C probably damaging Het
Tshz3 A G 7: 36,769,441 E285G probably damaging Het
Txndc11 C T 16: 11,084,792 V664M probably damaging Het
Ube2g1 A T 11: 72,663,082 N20Y probably damaging Het
Ufl1 T A 4: 25,265,476 I369L probably benign Het
Vwf A T 6: 125,683,526 T2666S probably benign Het
Yif1a A G 19: 5,092,341 M259V probably benign Het
Zbtb46 T C 2: 181,391,455 D471G probably damaging Het
Other mutations in Olfr461
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02232:Olfr461 APN 6 40544046 missense probably damaging 0.96
IGL03245:Olfr461 APN 6 40544142 missense probably damaging 0.98
R0325:Olfr461 UTSW 6 40544123 missense possibly damaging 0.95
R0835:Olfr461 UTSW 6 40544338 missense probably benign 0.01
R1594:Olfr461 UTSW 6 40544347 missense probably benign 0.00
R2437:Olfr461 UTSW 6 40544922 missense probably benign 0.37
R6970:Olfr461 UTSW 6 40544656 missense probably benign 0.31
R7252:Olfr461 UTSW 6 40544769 missense probably benign 0.06
R7326:Olfr461 UTSW 6 40544895 missense probably damaging 0.97
R8766:Olfr461 UTSW 6 40544551 missense probably benign
R9201:Olfr461 UTSW 6 40544359 missense probably benign 0.00
RF003:Olfr461 UTSW 6 40544362 missense probably benign 0.01
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2018-04-27