Mutagenetix > Incidental Mutation

Incidental Mutation 'R6360:Clstn3'

513064

Institutional Source

Beutler Lab

Gene Symbol

Clstn3

Ensembl Gene

ENSMUSG00000008153

Gene Name

calsyntenin 3

Synonyms

alcadein-beta, Cst-3, CSTN3

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6360 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

124430759-124464794 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 124438429 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Serine at position 659 (R659S)

Ref Sequence

ENSEMBL: ENSMUSP00000108142 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000008297] [ENSMUST00000112523]

AlphaFold

Q99JH7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000008297
AA Change: R696S

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000008297
Gene: ENSMUSG00000008153
AA Change: R696S

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
CA	50	143	2.72e-12	SMART
CA	166	244	4.04e-2	SMART
SCOP:d1a8d_1	333	549	7e-23	SMART
transmembrane domain	846	868	N/A	INTRINSIC
low complexity region	928	945	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000112523
AA Change: R659S

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000108142
Gene: ENSMUSG00000008153
AA Change: R659S

Domain	Start	End	E-Value	Type
CA	13	106	2.72e-12	SMART
CA	129	207	4.04e-2	SMART
Pfam:Laminin_G_3	304	505	4.1e-8	PFAM
transmembrane domain	809	831	N/A	INTRINSIC
low complexity region	891	908	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124998

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143283

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147947

Meta Mutation Damage Score

0.0692

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.2%

Validation Efficiency

98% (59/60)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit reductions in excitatory and inhibitory synapse density and deficits in synaptic transmission. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgap10	G	A	8: 77,259,202	Q657*	probably null	Het
Car15	T	C	16: 17,838,066	T560A	probably benign	Het
Cass4	C	T	2: 172,432,611	H769Y	probably damaging	Het
Cdh6	A	G	15: 13,041,460	I506T	possibly damaging	Het
Cntnap5b	C	T	1: 100,431,736	R695*	probably null	Het
Cpsf1	CCCCTGCATGAGGCAGGTCCC	CCCC	15: 76,597,455		probably null	Het
Dab2ip	A	G	2: 35,710,266	H355R	probably benign	Het
Dennd2a	C	T	6: 39,493,142	A539T	probably benign	Het
Dnajc18	T	C	18: 35,686,709	E173G	probably damaging	Het
Dock7	T	C	4: 98,969,662	I1472V	probably benign	Het
Esco1	A	T	18: 10,574,931	F714I	probably damaging	Het
Fam107a	T	G	14: 8,299,619	H73P	probably damaging	Het
Fam46b	T	C	4: 133,486,756	F313L	probably damaging	Het
Flg	A	G	3: 93,290,601		probably benign	Het
Fyn	C	A	10: 39,526,883	T217K	possibly damaging	Het
Gbp9	T	C	5: 105,083,730	D330G	probably benign	Het
Gin1	T	C	1: 97,792,539	S509P	possibly damaging	Het
Gm15922	A	T	7: 3,736,504	L455Q	probably damaging	Het
Gm17067	A	C	7: 42,708,482	S199A	probably benign	Het
Grk4	A	T	5: 34,674,537	K50M	probably damaging	Het
Inpp4b	A	G	8: 81,902,852	H272R	probably benign	Het
Ipo7	T	A	7: 110,027,129	L48Q	probably damaging	Het
Kbtbd2	A	G	6: 56,779,206	I515T	probably damaging	Het
Kcnu1	T	A	8: 25,861,180	S190R	possibly damaging	Het
Kpnb1	T	C	11: 97,173,270	N336S	probably benign	Het
Lbr	G	T	1: 181,832,155	D158E	probably benign	Het
Mphosph10	T	C	7: 64,389,955	Q89R	probably benign	Het
Nectin3	T	A	16: 46,411,109	T21S	probably benign	Het
Numb	C	A	12: 83,797,262	R383L	probably damaging	Het
Olfr1370	A	T	13: 21,072,583	N239K	probably damaging	Het
Olfr461	G	T	6: 40,544,713	Q89K	possibly damaging	Het
Park2	T	C	17: 12,004,052	F363S	probably damaging	Het
Pcdhb11	A	T	18: 37,422,159	I181F	probably benign	Het
Pcgf2	T	A	11: 97,692,409		probably null	Het
Pdzd8	T	C	19: 59,300,983	T662A	probably benign	Het
Pex13	A	C	11: 23,655,690	V180G	probably benign	Het
Pkp4	T	A	2: 59,214,747	V22D	probably benign	Het
Ppp1r32	T	C	19: 10,479,481	N167D	probably damaging	Het
Prpf4b	A	C	13: 34,901,433	D954A	probably damaging	Het
Rfx8	T	C	1: 39,680,965	I317V	probably benign	Het
Rnaseh2b	T	C	14: 62,361,419	S198P	probably damaging	Het
Rock1	A	T	18: 10,116,778	C453S	possibly damaging	Het
Scarf1	G	T	11: 75,515,669	G260W	probably damaging	Het
Scyl1	T	C	19: 5,760,571	E538G	probably damaging	Het
Sec14l5	A	T	16: 5,172,995	I267F	probably damaging	Het
Senp6	T	A	9: 80,113,806	V256D	probably benign	Het
Sf3b4	G	A	3: 96,176,728		probably benign	Het
Ssh1	T	C	5: 113,961,347		probably null	Het
Tas2r143	A	C	6: 42,400,835	M200L	probably benign	Het
Tbc1d22a	C	T	15: 86,214,629	P19S	probably damaging	Het
Tmc5	T	A	7: 118,633,966	M1K	probably null	Het
Tnc	T	C	4: 64,000,733	Y1151C	probably damaging	Het
Tshz3	A	G	7: 36,769,441	E285G	probably damaging	Het
Txndc11	C	T	16: 11,084,792	V664M	probably damaging	Het
Ube2g1	A	T	11: 72,663,082	N20Y	probably damaging	Het
Ufl1	T	A	4: 25,265,476	I369L	probably benign	Het
Vwf	A	T	6: 125,683,526	T2666S	probably benign	Het
Yif1a	A	G	19: 5,092,341	M259V	probably benign	Het
Zbtb46	T	C	2: 181,391,455	D471G	probably damaging	Het

Other mutations in Clstn3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01068:Clstn3	APN	6	124462139	missense	probably damaging	1.00
IGL01415:Clstn3	APN	6	124438822	nonsense	probably null
IGL01521:Clstn3	APN	6	124458031	nonsense	probably null
IGL01537:Clstn3	APN	6	124431600	missense	possibly damaging	0.91
IGL01729:Clstn3	APN	6	124449794	missense	probably benign	0.06
IGL01879:Clstn3	APN	6	124438810	missense	probably damaging	1.00
IGL01998:Clstn3	APN	6	124458663	missense	probably damaging	1.00
IGL03130:Clstn3	APN	6	124459263	missense	probably damaging	0.98
IGL03405:Clstn3	APN	6	124438368	missense	possibly damaging	0.95
PIT4403001:Clstn3	UTSW	6	124458023	missense	probably damaging	1.00
R0049:Clstn3	UTSW	6	124459853	missense	possibly damaging	0.87
R0049:Clstn3	UTSW	6	124459853	missense	possibly damaging	0.87
R0208:Clstn3	UTSW	6	124432169	splice site	probably benign
R0276:Clstn3	UTSW	6	124431740	splice site	probably benign
R0440:Clstn3	UTSW	6	124451413	missense	probably damaging	1.00
R0612:Clstn3	UTSW	6	124449500	missense	probably damaging	0.98
R1200:Clstn3	UTSW	6	124459170	missense	probably damaging	1.00
R1224:Clstn3	UTSW	6	124457919	missense	probably benign
R1378:Clstn3	UTSW	6	124438419	missense	probably damaging	1.00
R1491:Clstn3	UTSW	6	124437490	missense	possibly damaging	0.51
R1495:Clstn3	UTSW	6	124449917	missense	probably benign	0.00
R1511:Clstn3	UTSW	6	124462169	missense	probably damaging	1.00
R1655:Clstn3	UTSW	6	124437427	missense	probably damaging	1.00
R1731:Clstn3	UTSW	6	124431632	missense	probably benign	0.04
R1734:Clstn3	UTSW	6	124436814	splice site	probably benign
R1751:Clstn3	UTSW	6	124431999	missense	probably damaging	1.00
R1954:Clstn3	UTSW	6	124459298	missense	possibly damaging	0.94
R2133:Clstn3	UTSW	6	124449503	missense	probably benign
R2192:Clstn3	UTSW	6	124459207	missense	probably damaging	1.00
R2314:Clstn3	UTSW	6	124450717	missense	probably benign	0.39
R2874:Clstn3	UTSW	6	124438335	missense	probably damaging	1.00
R3500:Clstn3	UTSW	6	124431711	missense	probably benign	0.01
R3761:Clstn3	UTSW	6	124457876	missense	possibly damaging	0.54
R3878:Clstn3	UTSW	6	124457942	missense	probably damaging	0.97
R3927:Clstn3	UTSW	6	124451368	missense	probably damaging	1.00
R3934:Clstn3	UTSW	6	124457942	missense	probably damaging	0.97
R3935:Clstn3	UTSW	6	124457942	missense	probably damaging	0.97
R4063:Clstn3	UTSW	6	124449833	missense	possibly damaging	0.51
R4402:Clstn3	UTSW	6	124456980	missense	probably damaging	0.96
R4534:Clstn3	UTSW	6	124459220	missense	probably damaging	1.00
R4785:Clstn3	UTSW	6	124437372	splice site	probably null
R4834:Clstn3	UTSW	6	124431953	splice site	probably null
R5921:Clstn3	UTSW	6	124431580	utr 3 prime	probably benign
R5932:Clstn3	UTSW	6	124438332	missense	probably benign	0.01
R6025:Clstn3	UTSW	6	124431664	missense	possibly damaging	0.73
R6101:Clstn3	UTSW	6	124461670	missense	probably damaging	1.00
R6578:Clstn3	UTSW	6	124450704	critical splice donor site	probably null
R6813:Clstn3	UTSW	6	124436935	missense	probably benign	0.00
R7380:Clstn3	UTSW	6	124456989	missense	probably benign	0.01
R7419:Clstn3	UTSW	6	124458129	missense	probably benign	0.05
R7625:Clstn3	UTSW	6	124437418	nonsense	probably null
R7780:Clstn3	UTSW	6	124462202	missense	probably damaging	0.98
R7936:Clstn3	UTSW	6	124432013	missense	possibly damaging	0.73
R7939:Clstn3	UTSW	6	124462199	missense	probably damaging	1.00
R8047:Clstn3	UTSW	6	124432013	missense	possibly damaging	0.73
R8079:Clstn3	UTSW	6	124459804	missense	probably damaging	1.00
R8085:Clstn3	UTSW	6	124458724	missense	probably benign	0.23
R8299:Clstn3	UTSW	6	124437373	critical splice donor site	probably null
R8406:Clstn3	UTSW	6	124462177	missense	probably damaging	1.00
R8685:Clstn3	UTSW	6	124456908	missense	probably damaging	1.00
R9045:Clstn3	UTSW	6	124431962	missense	probably damaging	0.98
R9209:Clstn3	UTSW	6	124431612	missense	probably benign	0.02
R9264:Clstn3	UTSW	6	124459768	missense	probably damaging	1.00
R9268:Clstn3	UTSW	6	124456921	missense	probably damaging	0.99
R9443:Clstn3	UTSW	6	124451399	missense	probably damaging	1.00
RF014:Clstn3	UTSW	6	124459266	nonsense	probably null
X0066:Clstn3	UTSW	6	124449811	missense	probably benign	0.13
Z1176:Clstn3	UTSW	6	124459200	missense	probably damaging	1.00
Z1177:Clstn3	UTSW	6	124449781	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TCAGATGCTTGGCCTCACTG -3'
(R):5'- TGTGACTGAGAACAACTTACCC -3'

Sequencing Primer
(F):5'- TCACTGACCAGCAATGGTG -3'
(R):5'- TTAAAACCCAGAGCCTGTGG -3'

Posted On

2018-04-27