Incidental Mutation 'R6360:Gm15922'
ID513066
Institutional Source Beutler Lab
Gene Symbol Gm15922
Ensembl Gene ENSMUSG00000081665
Gene Namepredicted gene 15922
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R6360 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location3733021-3739861 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 3736504 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 455 (L455Q)
Ref Sequence ENSEMBL: ENSMUSP00000145713 (fasta)
Predicted Effect probably damaging
Transcript: ENSMUST00000118068
AA Change: L455Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap10 G A 8: 77,259,202 Q657* probably null Het
Car15 T C 16: 17,838,066 T560A probably benign Het
Cass4 C T 2: 172,432,611 H769Y probably damaging Het
Cdh6 A G 15: 13,041,460 I506T possibly damaging Het
Clstn3 G T 6: 124,438,429 R659S possibly damaging Het
Cntnap5b C T 1: 100,431,736 R695* probably null Het
Cpsf1 CCCCTGCATGAGGCAGGTCCC CCCC 15: 76,597,455 probably null Het
Dab2ip A G 2: 35,710,266 H355R probably benign Het
Dennd2a C T 6: 39,493,142 A539T probably benign Het
Dnajc18 T C 18: 35,686,709 E173G probably damaging Het
Dock7 T C 4: 98,969,662 I1472V probably benign Het
Esco1 A T 18: 10,574,931 F714I probably damaging Het
Fam107a T G 14: 8,299,619 H73P probably damaging Het
Fam46b T C 4: 133,486,756 F313L probably damaging Het
Flg A G 3: 93,290,601 probably benign Het
Fyn C A 10: 39,526,883 T217K possibly damaging Het
Gbp9 T C 5: 105,083,730 D330G probably benign Het
Gin1 T C 1: 97,792,539 S509P possibly damaging Het
Gm17067 A C 7: 42,708,482 S199A probably benign Het
Grk4 A T 5: 34,674,537 K50M probably damaging Het
Inpp4b A G 8: 81,902,852 H272R probably benign Het
Ipo7 T A 7: 110,027,129 L48Q probably damaging Het
Kbtbd2 A G 6: 56,779,206 I515T probably damaging Het
Kcnu1 T A 8: 25,861,180 S190R possibly damaging Het
Kpnb1 T C 11: 97,173,270 N336S probably benign Het
Lbr G T 1: 181,832,155 D158E probably benign Het
Mphosph10 T C 7: 64,389,955 Q89R probably benign Het
Nectin3 T A 16: 46,411,109 T21S probably benign Het
Numb C A 12: 83,797,262 R383L probably damaging Het
Olfr1370 A T 13: 21,072,583 N239K probably damaging Het
Olfr461 G T 6: 40,544,713 Q89K possibly damaging Het
Park2 T C 17: 12,004,052 F363S probably damaging Het
Pcdhb11 A T 18: 37,422,159 I181F probably benign Het
Pcgf2 T A 11: 97,692,409 probably null Het
Pdzd8 T C 19: 59,300,983 T662A probably benign Het
Pex13 A C 11: 23,655,690 V180G probably benign Het
Pkp4 T A 2: 59,214,747 V22D probably benign Het
Ppp1r32 T C 19: 10,479,481 N167D probably damaging Het
Prpf4b A C 13: 34,901,433 D954A probably damaging Het
Rfx8 T C 1: 39,680,965 I317V probably benign Het
Rnaseh2b T C 14: 62,361,419 S198P probably damaging Het
Rock1 A T 18: 10,116,778 C453S possibly damaging Het
Scarf1 G T 11: 75,515,669 G260W probably damaging Het
Scyl1 T C 19: 5,760,571 E538G probably damaging Het
Sec14l5 A T 16: 5,172,995 I267F probably damaging Het
Senp6 T A 9: 80,113,806 V256D probably benign Het
Sf3b4 G A 3: 96,176,728 probably benign Het
Ssh1 T C 5: 113,961,347 probably null Het
Tas2r143 A C 6: 42,400,835 M200L probably benign Het
Tbc1d22a C T 15: 86,214,629 P19S probably damaging Het
Tmc5 T A 7: 118,633,966 M1K probably null Het
Tnc T C 4: 64,000,733 Y1151C probably damaging Het
Tshz3 A G 7: 36,769,441 E285G probably damaging Het
Txndc11 C T 16: 11,084,792 V664M probably damaging Het
Ube2g1 A T 11: 72,663,082 N20Y probably damaging Het
Ufl1 T A 4: 25,265,476 I369L probably benign Het
Vwf A T 6: 125,683,526 T2666S probably benign Het
Yif1a A G 19: 5,092,341 M259V probably benign Het
Zbtb46 T C 2: 181,391,455 D471G probably damaging Het
Other mutations in Gm15922
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1514:Gm15922 UTSW 7 3739640 missense possibly damaging 0.82
R3902:Gm15922 UTSW 7 3737277 missense probably damaging 0.99
R4246:Gm15922 UTSW 7 3737349 missense probably damaging 1.00
R5125:Gm15922 UTSW 7 3739397 nonsense probably null
R5178:Gm15922 UTSW 7 3739397 nonsense probably null
R5388:Gm15922 UTSW 7 3738857 missense possibly damaging 0.49
R5471:Gm15922 UTSW 7 3735515 missense probably benign 0.02
R5985:Gm15922 UTSW 7 3737317 missense probably damaging 1.00
R6248:Gm15922 UTSW 7 3736338 missense probably benign
R6451:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R6453:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R6454:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R6455:Gm15922 UTSW 7 3738931 missense probably benign 0.00
R6594:Gm15922 UTSW 7 3736499 nonsense probably null
R6654:Gm15922 UTSW 7 3735929 missense probably benign 0.19
R6813:Gm15922 UTSW 7 3736003 missense probably benign 0.03
R6972:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R6975:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R7069:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R7072:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R7188:Gm15922 UTSW 7 3738829 missense probably damaging 0.99
R7304:Gm15922 UTSW 7 3737494 missense probably damaging 1.00
R7329:Gm15922 UTSW 7 3739876 start gained probably benign
R7404:Gm15922 UTSW 7 3739345 missense probably damaging 1.00
R7454:Gm15922 UTSW 7 3735510 missense probably benign 0.03
R7493:Gm15922 UTSW 7 3739024 missense not run
R7655:Gm15922 UTSW 7 3739282 missense probably damaging 0.98
R7656:Gm15922 UTSW 7 3739282 missense probably damaging 0.98
R7953:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R7956:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R7957:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R8037:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R8038:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R8043:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R8096:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R8117:Gm15922 UTSW 7 3737076 missense probably damaging 1.00
R8128:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R8134:Gm15922 UTSW 7 3735839 missense probably damaging 0.99
R8142:Gm15922 UTSW 7 3736843 missense possibly damaging 0.88
R8311:Gm15922 UTSW 7 3736483 missense probably benign 0.42
R8511:Gm15922 UTSW 7 3739348 missense probably damaging 1.00
R8519:Gm15922 UTSW 7 3737433 missense probably benign 0.27
R8928:Gm15922 UTSW 7 3739359 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGTGATCAGGATGTCCAGG -3'
(R):5'- TGTTCTCGAACACTGCCCTG -3'

Sequencing Primer
(F):5'- ATCAGGATGTCCAGGGGCTC -3'
(R):5'- TCGAACACTGCCCTGACTGG -3'
Posted On2018-04-27