Mutagenetix > Incidental Mutation

Incidental Mutation 'R6360:Ipo7'

513070

Institutional Source

Beutler Lab

Gene Symbol

Ipo7

Ensembl Gene

ENSMUSG00000066232

Gene Name

importin 7

Synonyms

A330055O14Rik, Imp7, RanBP7

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.961) question?

Stock #

R6360 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

110018274-110056609 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 110027129 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 48 (L48Q)

Ref Sequence

ENSEMBL: ENSMUSP00000146367 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084731] [ENSMUST00000208951]

AlphaFold

Q9EPL8

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000082666

Predicted Effect

possibly damaging
Transcript: ENSMUST00000084731
AA Change: L48Q

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000081782
Gene: ENSMUSG00000066232
AA Change: L48Q

Domain	Start	End	E-Value	Type
IBN_N	22	101	3.06e-15	SMART
Pfam:Cse1	168	452	2.8e-12	PFAM
low complexity region	701	712	N/A	INTRINSIC
low complexity region	881	900	N/A	INTRINSIC
low complexity region	923	939	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185931

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207277

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208408

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208821

Predicted Effect

probably damaging
Transcript: ENSMUST00000208951
AA Change: L48Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Meta Mutation Damage Score

0.2412

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.2%

Validation Efficiency

98% (59/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The importin-alpha/beta complex and the GTPase Ran mediate nuclear import of proteins with a classical nuclear localization signal. The protein encoded by this gene is a member of a class of approximately 20 potential Ran targets that share a sequence motif related to the Ran-binding site of importin-beta. Similar to importin-beta, this protein prevents the activation of Ran's GTPase by RanGAP1 and inhibits nucleotide exchange on RanGTP, and also binds directly to nuclear pore complexes where it competes for binding sites with importin-beta and transportin. This protein has a Ran-dependent transport cycle and it can cross the nuclear envelope rapidly and in both directions. At least four importin beta-like transport receptors, namely importin beta itself, transportin, RanBP5 and RanBP7, directly bind and import ribosomal proteins. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgap10	G	A	8: 77,259,202	Q657*	probably null	Het
Car15	T	C	16: 17,838,066	T560A	probably benign	Het
Cass4	C	T	2: 172,432,611	H769Y	probably damaging	Het
Cdh6	A	G	15: 13,041,460	I506T	possibly damaging	Het
Clstn3	G	T	6: 124,438,429	R659S	possibly damaging	Het
Cntnap5b	C	T	1: 100,431,736	R695*	probably null	Het
Cpsf1	CCCCTGCATGAGGCAGGTCCC	CCCC	15: 76,597,455		probably null	Het
Dab2ip	A	G	2: 35,710,266	H355R	probably benign	Het
Dennd2a	C	T	6: 39,493,142	A539T	probably benign	Het
Dnajc18	T	C	18: 35,686,709	E173G	probably damaging	Het
Dock7	T	C	4: 98,969,662	I1472V	probably benign	Het
Esco1	A	T	18: 10,574,931	F714I	probably damaging	Het
Fam107a	T	G	14: 8,299,619	H73P	probably damaging	Het
Fam46b	T	C	4: 133,486,756	F313L	probably damaging	Het
Flg	A	G	3: 93,290,601		probably benign	Het
Fyn	C	A	10: 39,526,883	T217K	possibly damaging	Het
Gbp9	T	C	5: 105,083,730	D330G	probably benign	Het
Gin1	T	C	1: 97,792,539	S509P	possibly damaging	Het
Gm15922	A	T	7: 3,736,504	L455Q	probably damaging	Het
Gm17067	A	C	7: 42,708,482	S199A	probably benign	Het
Grk4	A	T	5: 34,674,537	K50M	probably damaging	Het
Inpp4b	A	G	8: 81,902,852	H272R	probably benign	Het
Kbtbd2	A	G	6: 56,779,206	I515T	probably damaging	Het
Kcnu1	T	A	8: 25,861,180	S190R	possibly damaging	Het
Kpnb1	T	C	11: 97,173,270	N336S	probably benign	Het
Lbr	G	T	1: 181,832,155	D158E	probably benign	Het
Mphosph10	T	C	7: 64,389,955	Q89R	probably benign	Het
Nectin3	T	A	16: 46,411,109	T21S	probably benign	Het
Numb	C	A	12: 83,797,262	R383L	probably damaging	Het
Olfr1370	A	T	13: 21,072,583	N239K	probably damaging	Het
Olfr461	G	T	6: 40,544,713	Q89K	possibly damaging	Het
Park2	T	C	17: 12,004,052	F363S	probably damaging	Het
Pcdhb11	A	T	18: 37,422,159	I181F	probably benign	Het
Pcgf2	T	A	11: 97,692,409		probably null	Het
Pdzd8	T	C	19: 59,300,983	T662A	probably benign	Het
Pex13	A	C	11: 23,655,690	V180G	probably benign	Het
Pkp4	T	A	2: 59,214,747	V22D	probably benign	Het
Ppp1r32	T	C	19: 10,479,481	N167D	probably damaging	Het
Prpf4b	A	C	13: 34,901,433	D954A	probably damaging	Het
Rfx8	T	C	1: 39,680,965	I317V	probably benign	Het
Rnaseh2b	T	C	14: 62,361,419	S198P	probably damaging	Het
Rock1	A	T	18: 10,116,778	C453S	possibly damaging	Het
Scarf1	G	T	11: 75,515,669	G260W	probably damaging	Het
Scyl1	T	C	19: 5,760,571	E538G	probably damaging	Het
Sec14l5	A	T	16: 5,172,995	I267F	probably damaging	Het
Senp6	T	A	9: 80,113,806	V256D	probably benign	Het
Sf3b4	G	A	3: 96,176,728		probably benign	Het
Ssh1	T	C	5: 113,961,347		probably null	Het
Tas2r143	A	C	6: 42,400,835	M200L	probably benign	Het
Tbc1d22a	C	T	15: 86,214,629	P19S	probably damaging	Het
Tmc5	T	A	7: 118,633,966	M1K	probably null	Het
Tnc	T	C	4: 64,000,733	Y1151C	probably damaging	Het
Tshz3	A	G	7: 36,769,441	E285G	probably damaging	Het
Txndc11	C	T	16: 11,084,792	V664M	probably damaging	Het
Ube2g1	A	T	11: 72,663,082	N20Y	probably damaging	Het
Ufl1	T	A	4: 25,265,476	I369L	probably benign	Het
Vwf	A	T	6: 125,683,526	T2666S	probably benign	Het
Yif1a	A	G	19: 5,092,341	M259V	probably benign	Het
Zbtb46	T	C	2: 181,391,455	D471G	probably damaging	Het

Other mutations in Ipo7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01796:Ipo7	APN	7	110029848	intron	probably benign
IGL02472:Ipo7	APN	7	110040853	missense	probably damaging	1.00
IGL02502:Ipo7	APN	7	110051050	missense	probably damaging	1.00
IGL02514:Ipo7	APN	7	110048828	missense	possibly damaging	0.78
IGL02535:Ipo7	APN	7	110054026	missense	probably damaging	0.98
IGL02961:Ipo7	APN	7	110047016	missense	probably benign	0.02
R0089:Ipo7	UTSW	7	110050765	intron	probably benign
R0355:Ipo7	UTSW	7	110049661	missense	probably benign	0.00
R0565:Ipo7	UTSW	7	110049593	intron	probably benign
R1342:Ipo7	UTSW	7	110029804	missense	possibly damaging	0.82
R1405:Ipo7	UTSW	7	110029841	missense	probably benign	0.03
R1405:Ipo7	UTSW	7	110039249	missense	probably damaging	0.97
R1405:Ipo7	UTSW	7	110029841	missense	probably benign	0.03
R1405:Ipo7	UTSW	7	110039249	missense	probably damaging	0.97
R1791:Ipo7	UTSW	7	110027132	missense	probably damaging	0.98
R1838:Ipo7	UTSW	7	110042109	missense	probably damaging	1.00
R2116:Ipo7	UTSW	7	110051118	missense	probably damaging	0.99
R2120:Ipo7	UTSW	7	110049631	missense	probably damaging	1.00
R4366:Ipo7	UTSW	7	110029712	missense	possibly damaging	0.58
R4366:Ipo7	UTSW	7	110048216	missense	possibly damaging	0.88
R4805:Ipo7	UTSW	7	110051484	missense	probably benign	0.16
R5228:Ipo7	UTSW	7	110046762	missense	probably benign	0.00
R5903:Ipo7	UTSW	7	110050813	missense	probably damaging	1.00
R5976:Ipo7	UTSW	7	110048807	missense	probably damaging	1.00
R6254:Ipo7	UTSW	7	110049060	missense	probably benign	0.00
R6335:Ipo7	UTSW	7	110018468	missense	possibly damaging	0.92
R6776:Ipo7	UTSW	7	110047065	missense	probably damaging	0.98
R7132:Ipo7	UTSW	7	110054047	missense	probably benign	0.17
R7329:Ipo7	UTSW	7	110049017	missense	possibly damaging	0.94
R7491:Ipo7	UTSW	7	110039194	missense	possibly damaging	0.91
R7763:Ipo7	UTSW	7	110052799	missense	possibly damaging	0.62
R8070:Ipo7	UTSW	7	110052807	missense	probably benign	0.01
R8479:Ipo7	UTSW	7	110039245	missense	probably benign	0.23
R8547:Ipo7	UTSW	7	110052793	missense	probably benign	0.01
R8839:Ipo7	UTSW	7	110042016	missense	probably damaging	1.00
R8897:Ipo7	UTSW	7	110044736	critical splice donor site	probably null
R9024:Ipo7	UTSW	7	110044736	critical splice donor site	probably null
R9089:Ipo7	UTSW	7	110044459	missense	possibly damaging	0.79
R9245:Ipo7	UTSW	7	110044619	missense	probably damaging	1.00
RF017:Ipo7	UTSW	7	110048794	missense	probably benign	0.00
X0062:Ipo7	UTSW	7	110052886	missense	probably damaging	1.00
X0066:Ipo7	UTSW	7	110052734	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- AGTAAAGATGTTAGCTACTGGACC -3'
(R):5'- TGTAAGCCCTACTACCAAATATCAAGG -3'

Sequencing Primer
(F):5'- ACAATCAATCATTCAAAGGATTCAGG -3'
(R):5'- CCAAATATCAAGGTACCTGCTGTTGC -3'

Posted On

2018-04-27