Incidental Mutation 'R6360:Tmc5'
ID513071
Institutional Source Beutler Lab
Gene Symbol Tmc5
Ensembl Gene ENSMUSG00000030650
Gene Nametransmembrane channel-like gene family 5
Synonyms4932443L08Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001105252.1, NM_028930.3

Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R6360 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location118597297-118675086 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to A at 118633966 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000049784 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057320] [ENSMUST00000098088] [ENSMUST00000121715] [ENSMUST00000121744]
Predicted Effect probably null
Transcript: ENSMUST00000057320
AA Change: M1K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000049784
Gene: ENSMUSG00000030650
AA Change: M1K

DomainStartEndE-ValueType
transmembrane domain 203 225 N/A INTRINSIC
transmembrane domain 238 260 N/A INTRINSIC
transmembrane domain 275 297 N/A INTRINSIC
transmembrane domain 371 393 N/A INTRINSIC
transmembrane domain 408 430 N/A INTRINSIC
transmembrane domain 451 473 N/A INTRINSIC
Pfam:TMC 476 581 8.1e-44 PFAM
transmembrane domain 586 608 N/A INTRINSIC
transmembrane domain 652 674 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098088
SMART Domains Protein: ENSMUSP00000095694
Gene: ENSMUSG00000030650

DomainStartEndE-ValueType
internal_repeat_1 7 105 2.08e-10 PROSPERO
internal_repeat_2 10 108 2.75e-10 PROSPERO
internal_repeat_2 127 234 2.75e-10 PROSPERO
internal_repeat_1 152 266 2.08e-10 PROSPERO
transmembrane domain 413 435 N/A INTRINSIC
transmembrane domain 448 470 N/A INTRINSIC
transmembrane domain 485 507 N/A INTRINSIC
transmembrane domain 581 603 N/A INTRINSIC
transmembrane domain 618 640 N/A INTRINSIC
transmembrane domain 661 683 N/A INTRINSIC
Pfam:TMC 686 791 1.2e-42 PFAM
transmembrane domain 796 818 N/A INTRINSIC
transmembrane domain 862 884 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121715
SMART Domains Protein: ENSMUSP00000112434
Gene: ENSMUSG00000030650

DomainStartEndE-ValueType
internal_repeat_1 7 105 2.08e-10 PROSPERO
internal_repeat_2 10 108 2.75e-10 PROSPERO
internal_repeat_2 127 234 2.75e-10 PROSPERO
internal_repeat_1 152 266 2.08e-10 PROSPERO
transmembrane domain 413 435 N/A INTRINSIC
transmembrane domain 448 470 N/A INTRINSIC
transmembrane domain 485 507 N/A INTRINSIC
transmembrane domain 581 603 N/A INTRINSIC
transmembrane domain 618 640 N/A INTRINSIC
transmembrane domain 661 683 N/A INTRINSIC
Pfam:TMC 686 791 1.1e-43 PFAM
transmembrane domain 796 818 N/A INTRINSIC
transmembrane domain 862 884 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121744
SMART Domains Protein: ENSMUSP00000114137
Gene: ENSMUSG00000030650

DomainStartEndE-ValueType
internal_repeat_1 7 105 2.08e-10 PROSPERO
internal_repeat_2 10 108 2.75e-10 PROSPERO
internal_repeat_2 127 234 2.75e-10 PROSPERO
internal_repeat_1 152 266 2.08e-10 PROSPERO
transmembrane domain 413 435 N/A INTRINSIC
transmembrane domain 448 470 N/A INTRINSIC
transmembrane domain 485 507 N/A INTRINSIC
transmembrane domain 581 603 N/A INTRINSIC
transmembrane domain 618 640 N/A INTRINSIC
transmembrane domain 661 683 N/A INTRINSIC
Pfam:TMC 686 791 1.1e-43 PFAM
transmembrane domain 796 818 N/A INTRINSIC
transmembrane domain 862 884 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 98% (59/60)
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap10 G A 8: 77,259,202 Q657* probably null Het
Car15 T C 16: 17,838,066 T560A probably benign Het
Cass4 C T 2: 172,432,611 H769Y probably damaging Het
Cdh6 A G 15: 13,041,460 I506T possibly damaging Het
Clstn3 G T 6: 124,438,429 R659S possibly damaging Het
Cntnap5b C T 1: 100,431,736 R695* probably null Het
Cpsf1 CCCCTGCATGAGGCAGGTCCC CCCC 15: 76,597,455 probably null Het
Dab2ip A G 2: 35,710,266 H355R probably benign Het
Dennd2a C T 6: 39,493,142 A539T probably benign Het
Dnajc18 T C 18: 35,686,709 E173G probably damaging Het
Dock7 T C 4: 98,969,662 I1472V probably benign Het
Esco1 A T 18: 10,574,931 F714I probably damaging Het
Fam107a T G 14: 8,299,619 H73P probably damaging Het
Fam46b T C 4: 133,486,756 F313L probably damaging Het
Flg A G 3: 93,290,601 probably benign Het
Fyn C A 10: 39,526,883 T217K possibly damaging Het
Gbp9 T C 5: 105,083,730 D330G probably benign Het
Gin1 T C 1: 97,792,539 S509P possibly damaging Het
Gm15922 A T 7: 3,736,504 L455Q probably damaging Het
Gm17067 A C 7: 42,708,482 S199A probably benign Het
Grk4 A T 5: 34,674,537 K50M probably damaging Het
Inpp4b A G 8: 81,902,852 H272R probably benign Het
Ipo7 T A 7: 110,027,129 L48Q probably damaging Het
Kbtbd2 A G 6: 56,779,206 I515T probably damaging Het
Kcnu1 T A 8: 25,861,180 S190R possibly damaging Het
Kpnb1 T C 11: 97,173,270 N336S probably benign Het
Lbr G T 1: 181,832,155 D158E probably benign Het
Mphosph10 T C 7: 64,389,955 Q89R probably benign Het
Nectin3 T A 16: 46,411,109 T21S probably benign Het
Numb C A 12: 83,797,262 R383L probably damaging Het
Olfr1370 A T 13: 21,072,583 N239K probably damaging Het
Olfr461 G T 6: 40,544,713 Q89K possibly damaging Het
Park2 T C 17: 12,004,052 F363S probably damaging Het
Pcdhb11 A T 18: 37,422,159 I181F probably benign Het
Pcgf2 T A 11: 97,692,409 probably null Het
Pdzd8 T C 19: 59,300,983 T662A probably benign Het
Pex13 A C 11: 23,655,690 V180G probably benign Het
Pkp4 T A 2: 59,214,747 V22D probably benign Het
Ppp1r32 T C 19: 10,479,481 N167D probably damaging Het
Prpf4b A C 13: 34,901,433 D954A probably damaging Het
Rfx8 T C 1: 39,680,965 I317V probably benign Het
Rnaseh2b T C 14: 62,361,419 S198P probably damaging Het
Rock1 A T 18: 10,116,778 C453S possibly damaging Het
Scarf1 G T 11: 75,515,669 G260W probably damaging Het
Scyl1 T C 19: 5,760,571 E538G probably damaging Het
Sec14l5 A T 16: 5,172,995 I267F probably damaging Het
Senp6 T A 9: 80,113,806 V256D probably benign Het
Sf3b4 G A 3: 96,176,728 probably benign Het
Ssh1 T C 5: 113,961,347 probably null Het
Tas2r143 A C 6: 42,400,835 M200L probably benign Het
Tbc1d22a C T 15: 86,214,629 P19S probably damaging Het
Tnc T C 4: 64,000,733 Y1151C probably damaging Het
Tshz3 A G 7: 36,769,441 E285G probably damaging Het
Txndc11 C T 16: 11,084,792 V664M probably damaging Het
Ube2g1 A T 11: 72,663,082 N20Y probably damaging Het
Ufl1 T A 4: 25,265,476 I369L probably benign Het
Vwf A T 6: 125,683,526 T2666S probably benign Het
Yif1a A G 19: 5,092,341 M259V probably benign Het
Zbtb46 T C 2: 181,391,455 D471G probably damaging Het
Other mutations in Tmc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01484:Tmc5 APN 7 118656787 missense probably damaging 1.00
IGL01601:Tmc5 APN 7 118623824 unclassified probably benign
IGL01633:Tmc5 APN 7 118623586 missense probably damaging 0.97
IGL01845:Tmc5 APN 7 118652510 missense possibly damaging 0.93
IGL02148:Tmc5 APN 7 118645324 missense probably damaging 0.97
IGL02638:Tmc5 APN 7 118627233 missense probably benign 0.36
IGL02890:Tmc5 APN 7 118645430 splice site probably benign
hipster UTSW 7 118666611 critical splice donor site probably null
F5426:Tmc5 UTSW 7 118623323 missense probably benign
PIT4802001:Tmc5 UTSW 7 118672226 missense probably benign
R0068:Tmc5 UTSW 7 118634237 missense probably benign 0.44
R0470:Tmc5 UTSW 7 118639931 missense possibly damaging 0.68
R0520:Tmc5 UTSW 7 118666576 missense probably damaging 1.00
R0786:Tmc5 UTSW 7 118627210 missense possibly damaging 0.94
R1263:Tmc5 UTSW 7 118666870 missense probably damaging 1.00
R1269:Tmc5 UTSW 7 118666593 missense probably benign 0.30
R1486:Tmc5 UTSW 7 118673432 missense probably benign 0.02
R1702:Tmc5 UTSW 7 118672239 missense probably benign 0.00
R2188:Tmc5 UTSW 7 118654955 missense probably damaging 1.00
R3508:Tmc5 UTSW 7 118645395 missense probably benign 0.01
R3893:Tmc5 UTSW 7 118645369 missense probably damaging 1.00
R3927:Tmc5 UTSW 7 118652655 nonsense probably null
R4171:Tmc5 UTSW 7 118649587 missense probably damaging 0.99
R4279:Tmc5 UTSW 7 118674663 makesense probably null
R4554:Tmc5 UTSW 7 118670733 missense probably benign 0.16
R4555:Tmc5 UTSW 7 118670733 missense probably benign 0.16
R4557:Tmc5 UTSW 7 118670733 missense probably benign 0.16
R4833:Tmc5 UTSW 7 118628829 missense probably benign 0.11
R4845:Tmc5 UTSW 7 118642381 missense probably damaging 1.00
R4852:Tmc5 UTSW 7 118645339 missense probably benign 0.32
R5087:Tmc5 UTSW 7 118645386 missense possibly damaging 0.68
R5214:Tmc5 UTSW 7 118647932 missense probably damaging 1.00
R5723:Tmc5 UTSW 7 118672193 missense probably damaging 1.00
R5739:Tmc5 UTSW 7 118666611 critical splice donor site probably null
R5882:Tmc5 UTSW 7 118654919 missense probably damaging 0.99
R5946:Tmc5 UTSW 7 118670725 missense probably damaging 1.00
R6244:Tmc5 UTSW 7 118634214 missense possibly damaging 0.93
R6375:Tmc5 UTSW 7 118656814 missense probably damaging 1.00
R6458:Tmc5 UTSW 7 118645316 missense probably damaging 1.00
R6566:Tmc5 UTSW 7 118647844 missense probably damaging 1.00
R6681:Tmc5 UTSW 7 118669304 missense probably damaging 1.00
R7202:Tmc5 UTSW 7 118639956 missense possibly damaging 0.49
R7227:Tmc5 UTSW 7 118670666 missense possibly damaging 0.81
R7410:Tmc5 UTSW 7 118623597 nonsense probably null
R7562:Tmc5 UTSW 7 118623326 missense probably benign 0.10
R7808:Tmc5 UTSW 7 118669217 missense probably damaging 1.00
Z1177:Tmc5 UTSW 7 118623756 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCAAGGCAATATTCTCTGTAGAG -3'
(R):5'- CCCAGGGTTGAAAATCTGACAG -3'

Sequencing Primer
(F):5'- GAGAAATGTGTCTCCTCCTAAGG -3'
(R):5'- GGGTTGAAAATCTGACAGTCTACCC -3'
Posted On2018-04-27