Incidental Mutation 'R6360:Arhgap10'
ID 513073
Institutional Source Beutler Lab
Gene Symbol Arhgap10
Ensembl Gene ENSMUSG00000037148
Gene Name Rho GTPase activating protein 10
Synonyms PSGAP-s, A930033B01Rik, PSGAP-m
MMRRC Submission 044510-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.165) question?
Stock # R6360 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 77976995-78244582 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 77985831 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 657 (Q657*)
Ref Sequence ENSEMBL: ENSMUSP00000147493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076316] [ENSMUST00000210519] [ENSMUST00000210922]
AlphaFold Q6Y5D8
Predicted Effect probably null
Transcript: ENSMUST00000076316
AA Change: Q679*
SMART Domains Protein: ENSMUSP00000075658
Gene: ENSMUSG00000037148
AA Change: Q679*

DomainStartEndE-ValueType
Pfam:BAR_3 6 249 3.3e-91 PFAM
PH 266 374 1.93e-6 SMART
RhoGAP 393 571 1.66e-63 SMART
low complexity region 633 649 N/A INTRINSIC
SH3 731 786 1.91e-13 SMART
Predicted Effect probably null
Transcript: ENSMUST00000210519
AA Change: Q657*
Predicted Effect probably benign
Transcript: ENSMUST00000210922
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 98% (59/60)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit paraparesis, ataxic hindlimbs and splaying of hindlimbs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Car15 T C 16: 17,655,930 (GRCm39) T560A probably benign Het
Cass4 C T 2: 172,274,531 (GRCm39) H769Y probably damaging Het
Cdh6 A G 15: 13,041,546 (GRCm39) I506T possibly damaging Het
Clstn3 G T 6: 124,415,388 (GRCm39) R659S possibly damaging Het
Cntnap5b C T 1: 100,359,461 (GRCm39) R695* probably null Het
Cpsf1 CCCCTGCATGAGGCAGGTCCC CCCC 15: 76,481,655 (GRCm39) probably null Het
Dab2ip A G 2: 35,600,278 (GRCm39) H355R probably benign Het
Dennd2a C T 6: 39,470,076 (GRCm39) A539T probably benign Het
Dnajc18 T C 18: 35,819,762 (GRCm39) E173G probably damaging Het
Dock7 T C 4: 98,857,899 (GRCm39) I1472V probably benign Het
Esco1 A T 18: 10,574,931 (GRCm39) F714I probably damaging Het
Fam107a T G 14: 8,299,619 (GRCm38) H73P probably damaging Het
Flg A G 3: 93,197,908 (GRCm39) probably benign Het
Fyn C A 10: 39,402,879 (GRCm39) T217K possibly damaging Het
Gbp9 T C 5: 105,231,596 (GRCm39) D330G probably benign Het
Gin1 T C 1: 97,720,264 (GRCm39) S509P possibly damaging Het
Gm17067 A C 7: 42,357,906 (GRCm39) S199A probably benign Het
Grk4 A T 5: 34,831,881 (GRCm39) K50M probably damaging Het
Inpp4b A G 8: 82,629,481 (GRCm39) H272R probably benign Het
Ipo7 T A 7: 109,626,336 (GRCm39) L48Q probably damaging Het
Kbtbd2 A G 6: 56,756,191 (GRCm39) I515T probably damaging Het
Kcnu1 T A 8: 26,351,208 (GRCm39) S190R possibly damaging Het
Kpnb1 T C 11: 97,064,096 (GRCm39) N336S probably benign Het
Lbr G T 1: 181,659,720 (GRCm39) D158E probably benign Het
Mphosph10 T C 7: 64,039,703 (GRCm39) Q89R probably benign Het
Nectin3 T A 16: 46,231,472 (GRCm39) T21S probably benign Het
Numb C A 12: 83,844,036 (GRCm39) R383L probably damaging Het
Or2p2 A T 13: 21,256,753 (GRCm39) N239K probably damaging Het
Or9a7 G T 6: 40,521,647 (GRCm39) Q89K possibly damaging Het
Pcdhb11 A T 18: 37,555,212 (GRCm39) I181F probably benign Het
Pcgf2 T A 11: 97,583,235 (GRCm39) probably null Het
Pdzd8 T C 19: 59,289,415 (GRCm39) T662A probably benign Het
Pex13 A C 11: 23,605,690 (GRCm39) V180G probably benign Het
Pira1 A T 7: 3,739,503 (GRCm39) L455Q probably damaging Het
Pkp4 T A 2: 59,045,091 (GRCm39) V22D probably benign Het
Prkn T C 17: 12,222,939 (GRCm39) F363S probably damaging Het
Prpf4b A C 13: 35,085,416 (GRCm39) D954A probably damaging Het
Rfx8 T C 1: 39,720,125 (GRCm39) I317V probably benign Het
Rnaseh2b T C 14: 62,598,868 (GRCm39) S198P probably damaging Het
Rock1 A T 18: 10,116,778 (GRCm39) C453S possibly damaging Het
Saxo4 T C 19: 10,456,845 (GRCm39) N167D probably damaging Het
Scarf1 G T 11: 75,406,495 (GRCm39) G260W probably damaging Het
Scyl1 T C 19: 5,810,599 (GRCm39) E538G probably damaging Het
Sec14l5 A T 16: 4,990,859 (GRCm39) I267F probably damaging Het
Senp6 T A 9: 80,021,088 (GRCm39) V256D probably benign Het
Sf3b4 G A 3: 96,084,044 (GRCm39) probably benign Het
Ssh1 T C 5: 114,099,408 (GRCm39) probably null Het
Tas2r143 A C 6: 42,377,769 (GRCm39) M200L probably benign Het
Tbc1d22a C T 15: 86,098,830 (GRCm39) P19S probably damaging Het
Tent5b T C 4: 133,214,067 (GRCm39) F313L probably damaging Het
Tmc5 T A 7: 118,233,189 (GRCm39) M1K probably null Het
Tnc T C 4: 63,918,970 (GRCm39) Y1151C probably damaging Het
Tshz3 A G 7: 36,468,866 (GRCm39) E285G probably damaging Het
Txndc11 C T 16: 10,902,656 (GRCm39) V664M probably damaging Het
Ube2g1 A T 11: 72,553,908 (GRCm39) N20Y probably damaging Het
Ufl1 T A 4: 25,265,476 (GRCm39) I369L probably benign Het
Vwf A T 6: 125,660,489 (GRCm39) T2666S probably benign Het
Yif1a A G 19: 5,142,369 (GRCm39) M259V probably benign Het
Zbtb46 T C 2: 181,033,248 (GRCm39) D471G probably damaging Het
Other mutations in Arhgap10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01529:Arhgap10 APN 8 78,072,920 (GRCm39) missense possibly damaging 0.80
IGL01689:Arhgap10 APN 8 78,137,763 (GRCm39) splice site probably benign
IGL01802:Arhgap10 APN 8 78,146,714 (GRCm39) missense probably damaging 0.99
IGL01832:Arhgap10 APN 8 77,985,758 (GRCm39) missense probably benign 0.00
IGL02291:Arhgap10 APN 8 78,109,344 (GRCm39) splice site probably benign
IGL02834:Arhgap10 APN 8 78,091,729 (GRCm39) missense probably damaging 1.00
IGL02928:Arhgap10 APN 8 77,977,539 (GRCm39) unclassified probably benign
IGL03149:Arhgap10 APN 8 78,136,167 (GRCm39) splice site probably benign
IGL03215:Arhgap10 APN 8 78,003,781 (GRCm39) missense probably benign
IGL03331:Arhgap10 APN 8 78,146,711 (GRCm39) missense probably damaging 0.99
R0276:Arhgap10 UTSW 8 78,140,210 (GRCm39) missense probably benign 0.11
R0376:Arhgap10 UTSW 8 78,177,453 (GRCm39) splice site probably benign
R0454:Arhgap10 UTSW 8 77,977,594 (GRCm39) missense probably damaging 0.97
R0714:Arhgap10 UTSW 8 78,078,316 (GRCm39) splice site probably benign
R1033:Arhgap10 UTSW 8 77,983,976 (GRCm39) missense possibly damaging 0.80
R1036:Arhgap10 UTSW 8 78,037,398 (GRCm39) missense probably damaging 0.98
R1083:Arhgap10 UTSW 8 78,244,378 (GRCm39) missense probably damaging 1.00
R1596:Arhgap10 UTSW 8 78,177,326 (GRCm39) missense possibly damaging 0.93
R1710:Arhgap10 UTSW 8 78,085,216 (GRCm39) nonsense probably null
R1918:Arhgap10 UTSW 8 77,985,708 (GRCm39) missense probably benign
R1937:Arhgap10 UTSW 8 78,071,282 (GRCm39) missense probably damaging 1.00
R1959:Arhgap10 UTSW 8 78,136,255 (GRCm39) missense possibly damaging 0.78
R2348:Arhgap10 UTSW 8 78,177,555 (GRCm39) splice site probably benign
R3703:Arhgap10 UTSW 8 77,985,685 (GRCm39) critical splice donor site probably null
R3979:Arhgap10 UTSW 8 78,147,354 (GRCm39) missense probably benign 0.01
R4854:Arhgap10 UTSW 8 78,146,718 (GRCm39) nonsense probably null
R4855:Arhgap10 UTSW 8 78,159,367 (GRCm39) critical splice donor site probably null
R4928:Arhgap10 UTSW 8 78,152,957 (GRCm39) critical splice donor site probably null
R5033:Arhgap10 UTSW 8 78,109,386 (GRCm39) missense probably damaging 0.99
R5532:Arhgap10 UTSW 8 78,146,701 (GRCm39) missense probably benign 0.19
R5644:Arhgap10 UTSW 8 78,137,684 (GRCm39) missense probably benign 0.00
R5781:Arhgap10 UTSW 8 78,177,336 (GRCm39) missense possibly damaging 0.56
R5824:Arhgap10 UTSW 8 78,085,181 (GRCm39) nonsense probably null
R5861:Arhgap10 UTSW 8 78,037,393 (GRCm39) missense probably damaging 1.00
R5872:Arhgap10 UTSW 8 78,071,267 (GRCm39) critical splice donor site probably null
R6423:Arhgap10 UTSW 8 78,244,386 (GRCm39) missense probably damaging 1.00
R6694:Arhgap10 UTSW 8 78,137,692 (GRCm39) missense probably benign 0.00
R6900:Arhgap10 UTSW 8 78,037,491 (GRCm39) missense probably damaging 1.00
R6936:Arhgap10 UTSW 8 78,037,376 (GRCm39) nonsense probably null
R7001:Arhgap10 UTSW 8 78,091,717 (GRCm39) missense possibly damaging 0.51
R7150:Arhgap10 UTSW 8 77,977,583 (GRCm39) missense probably damaging 1.00
R7461:Arhgap10 UTSW 8 78,115,326 (GRCm39) missense probably damaging 0.99
R7525:Arhgap10 UTSW 8 78,146,699 (GRCm39) critical splice donor site probably null
R8051:Arhgap10 UTSW 8 78,244,309 (GRCm39) missense probably damaging 0.97
R8081:Arhgap10 UTSW 8 78,109,375 (GRCm39) missense possibly damaging 0.68
R8175:Arhgap10 UTSW 8 78,037,471 (GRCm39) missense probably benign 0.03
R8262:Arhgap10 UTSW 8 78,037,468 (GRCm39) missense probably benign
R8702:Arhgap10 UTSW 8 77,985,732 (GRCm39) missense probably benign
R8778:Arhgap10 UTSW 8 78,140,240 (GRCm39) missense probably damaging 1.00
R9015:Arhgap10 UTSW 8 77,985,687 (GRCm39) missense probably benign
R9113:Arhgap10 UTSW 8 77,985,701 (GRCm39) missense probably damaging 1.00
R9275:Arhgap10 UTSW 8 78,137,665 (GRCm39) missense probably damaging 1.00
R9457:Arhgap10 UTSW 8 78,111,415 (GRCm39) missense probably benign 0.43
R9623:Arhgap10 UTSW 8 77,985,786 (GRCm39) missense probably benign
Z1176:Arhgap10 UTSW 8 78,159,434 (GRCm39) missense probably damaging 0.97
Z1176:Arhgap10 UTSW 8 78,003,804 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATCCAGGGCAAGCATTTCCTAAG -3'
(R):5'- AAGTGGCTCAGGGTGTAGTC -3'

Sequencing Primer
(F):5'- TTTCCTAAGAGGGATGTCACAGCC -3'
(R):5'- CCTGGGAAGGTACAGAGAACTCTAC -3'
Posted On 2018-04-27