Mutagenetix > Incidental Mutation

Incidental Mutation 'R6360:Senp6'

513075

Institutional Source

Beutler Lab

Gene Symbol

Senp6

Ensembl Gene

ENSMUSG00000034252

Gene Name

SUMO/sentrin specific peptidase 6

Synonyms

E130319N12Rik, 2810017C20Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6360 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

80066903-80144953 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 80113806 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 256 (V256D)

Ref Sequence

ENSEMBL: ENSMUSP00000126777 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037484] [ENSMUST00000164859] [ENSMUST00000165607] [ENSMUST00000175999] [ENSMUST00000176360] [ENSMUST00000176640]

AlphaFold

Q6P7W0

Predicted Effect

probably benign
Transcript: ENSMUST00000037484
AA Change: V249D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000047220
Gene: ENSMUSG00000034252
AA Change: V249D

Domain	Start	End	E-Value	Type
low complexity region	2	12	N/A	INTRINSIC
ZnF_C2HC	242	260	7.23e0	SMART
Pfam:Peptidase_C48	700	826	3.5e-23	PFAM
Pfam:Peptidase_C48	965	1096	1.1e-14	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000164859
AA Change: V83D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000128918
Gene: ENSMUSG00000034252
AA Change: V83D

Domain	Start	End	E-Value	Type
ZnF_C2HC	76	94	7.23e0	SMART
Pfam:Peptidase_C48	534	660	5.2e-23	PFAM
Pfam:Peptidase_C48	799	930	1.6e-14	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000165607
AA Change: V256D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000126777
Gene: ENSMUSG00000034252
AA Change: V256D

Domain	Start	End	E-Value	Type
low complexity region	2	12	N/A	INTRINSIC
ZnF_C2HC	249	267	7.23e0	SMART
Pfam:Peptidase_C48	707	833	3.4e-23	PFAM
Pfam:Peptidase_C48	972	1103	1.1e-14	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000175910

Predicted Effect

probably benign
Transcript: ENSMUST00000175999

Predicted Effect

probably benign
Transcript: ENSMUST00000176360

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176607

SMART Domains

Protein: ENSMUSP00000135231
Gene: ENSMUSG00000034252

Domain	Start	End	E-Value	Type
ZnF_C2HC	76	94	7.23e0	SMART
Pfam:Peptidase_C48	534	660	4.9e-23	PFAM
Pfam:Peptidase_C48	799	911	2.1e-14	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000176640

Predicted Effect

probably benign
Transcript: ENSMUST00000176648

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.2%

Validation Efficiency

98% (59/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ubiquitin-like molecules (UBLs), such as SUMO1 (UBL1; MIM 601912), are structurally related to ubiquitin (MIM 191339) and can be ligated to target proteins in a similar manner as ubiquitin. However, covalent attachment of UBLs does not result in degradation of the modified proteins. SUMO1 modification is implicated in the targeting of RANGAP1 (MIM 602362) to the nuclear pore complex, as well as in stabilization of I-kappa-B-alpha (NFKBIA; MIM 164008) from degradation by the 26S proteasome. Like ubiquitin, UBLs are synthesized as precursor proteins, with 1 or more amino acids following the C-terminal glycine-glycine residues of the mature UBL protein. Thus, the tail sequences of the UBL precursors need to be removed by UBL-specific proteases, such as SENP6, prior to their conjugation to target proteins (Kim et al., 2000 [PubMed 10799485]). SENPs also display isopeptidase activity for deconjugation of SUMO-conjugated substrates (Lima and Reverter, 2008 [PubMed 18799455]).[supplied by OMIM, Jun 2009]
PHENOTYPE: Mice homozygous for a gene trap insertion exhibit prenatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgap10	G	A	8: 77,259,202	Q657*	probably null	Het
Car15	T	C	16: 17,838,066	T560A	probably benign	Het
Cass4	C	T	2: 172,432,611	H769Y	probably damaging	Het
Cdh6	A	G	15: 13,041,460	I506T	possibly damaging	Het
Clstn3	G	T	6: 124,438,429	R659S	possibly damaging	Het
Cntnap5b	C	T	1: 100,431,736	R695*	probably null	Het
Cpsf1	CCCCTGCATGAGGCAGGTCCC	CCCC	15: 76,597,455		probably null	Het
Dab2ip	A	G	2: 35,710,266	H355R	probably benign	Het
Dennd2a	C	T	6: 39,493,142	A539T	probably benign	Het
Dnajc18	T	C	18: 35,686,709	E173G	probably damaging	Het
Dock7	T	C	4: 98,969,662	I1472V	probably benign	Het
Esco1	A	T	18: 10,574,931	F714I	probably damaging	Het
Fam107a	T	G	14: 8,299,619	H73P	probably damaging	Het
Fam46b	T	C	4: 133,486,756	F313L	probably damaging	Het
Flg	A	G	3: 93,290,601		probably benign	Het
Fyn	C	A	10: 39,526,883	T217K	possibly damaging	Het
Gbp9	T	C	5: 105,083,730	D330G	probably benign	Het
Gin1	T	C	1: 97,792,539	S509P	possibly damaging	Het
Gm15922	A	T	7: 3,736,504	L455Q	probably damaging	Het
Gm17067	A	C	7: 42,708,482	S199A	probably benign	Het
Grk4	A	T	5: 34,674,537	K50M	probably damaging	Het
Inpp4b	A	G	8: 81,902,852	H272R	probably benign	Het
Ipo7	T	A	7: 110,027,129	L48Q	probably damaging	Het
Kbtbd2	A	G	6: 56,779,206	I515T	probably damaging	Het
Kcnu1	T	A	8: 25,861,180	S190R	possibly damaging	Het
Kpnb1	T	C	11: 97,173,270	N336S	probably benign	Het
Lbr	G	T	1: 181,832,155	D158E	probably benign	Het
Mphosph10	T	C	7: 64,389,955	Q89R	probably benign	Het
Nectin3	T	A	16: 46,411,109	T21S	probably benign	Het
Numb	C	A	12: 83,797,262	R383L	probably damaging	Het
Olfr1370	A	T	13: 21,072,583	N239K	probably damaging	Het
Olfr461	G	T	6: 40,544,713	Q89K	possibly damaging	Het
Park2	T	C	17: 12,004,052	F363S	probably damaging	Het
Pcdhb11	A	T	18: 37,422,159	I181F	probably benign	Het
Pcgf2	T	A	11: 97,692,409		probably null	Het
Pdzd8	T	C	19: 59,300,983	T662A	probably benign	Het
Pex13	A	C	11: 23,655,690	V180G	probably benign	Het
Pkp4	T	A	2: 59,214,747	V22D	probably benign	Het
Ppp1r32	T	C	19: 10,479,481	N167D	probably damaging	Het
Prpf4b	A	C	13: 34,901,433	D954A	probably damaging	Het
Rfx8	T	C	1: 39,680,965	I317V	probably benign	Het
Rnaseh2b	T	C	14: 62,361,419	S198P	probably damaging	Het
Rock1	A	T	18: 10,116,778	C453S	possibly damaging	Het
Scarf1	G	T	11: 75,515,669	G260W	probably damaging	Het
Scyl1	T	C	19: 5,760,571	E538G	probably damaging	Het
Sec14l5	A	T	16: 5,172,995	I267F	probably damaging	Het
Sf3b4	G	A	3: 96,176,728		probably benign	Het
Ssh1	T	C	5: 113,961,347		probably null	Het
Tas2r143	A	C	6: 42,400,835	M200L	probably benign	Het
Tbc1d22a	C	T	15: 86,214,629	P19S	probably damaging	Het
Tmc5	T	A	7: 118,633,966	M1K	probably null	Het
Tnc	T	C	4: 64,000,733	Y1151C	probably damaging	Het
Tshz3	A	G	7: 36,769,441	E285G	probably damaging	Het
Txndc11	C	T	16: 11,084,792	V664M	probably damaging	Het
Ube2g1	A	T	11: 72,663,082	N20Y	probably damaging	Het
Ufl1	T	A	4: 25,265,476	I369L	probably benign	Het
Vwf	A	T	6: 125,683,526	T2666S	probably benign	Het
Yif1a	A	G	19: 5,092,341	M259V	probably benign	Het
Zbtb46	T	C	2: 181,391,455	D471G	probably damaging	Het

Other mutations in Senp6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Senp6	APN	9	80116610	missense	probably damaging	1.00
IGL00487:Senp6	APN	9	80113838	missense	probably damaging	1.00
IGL01285:Senp6	APN	9	80136718	missense	probably benign	0.05
IGL01337:Senp6	APN	9	80136510	missense	probably damaging	0.97
IGL01563:Senp6	APN	9	80122008	missense	probably benign
IGL01633:Senp6	APN	9	80092394	missense	probably damaging	1.00
IGL02115:Senp6	APN	9	80121926	missense	probably damaging	1.00
IGL02208:Senp6	APN	9	80113943	missense	probably damaging	1.00
IGL02378:Senp6	APN	9	80126392	missense	probably damaging	1.00
A4554:Senp6	UTSW	9	80148458	unclassified	probably benign
R0031:Senp6	UTSW	9	80126243	missense	probably damaging	1.00
R0121:Senp6	UTSW	9	80116670	missense	probably benign	0.01
R0276:Senp6	UTSW	9	80136747	missense	probably benign
R0294:Senp6	UTSW	9	80113725	splice site	probably null
R0308:Senp6	UTSW	9	80132983	critical splice donor site	probably null
R0531:Senp6	UTSW	9	80123884	missense	probably damaging	0.99
R0743:Senp6	UTSW	9	80093589	missense	probably damaging	1.00
R0883:Senp6	UTSW	9	80116559	missense	probably damaging	1.00
R1071:Senp6	UTSW	9	80136729	missense	probably benign	0.35
R1171:Senp6	UTSW	9	80116725	missense	possibly damaging	0.89
R1340:Senp6	UTSW	9	80122023	missense	possibly damaging	0.47
R1571:Senp6	UTSW	9	80093571	missense	probably damaging	1.00
R1760:Senp6	UTSW	9	80118629	missense	probably benign	0.36
R1909:Senp6	UTSW	9	80113774	missense	possibly damaging	0.67
R2008:Senp6	UTSW	9	80126398	missense	probably damaging	1.00
R2067:Senp6	UTSW	9	80089869	missense	probably benign	0.11
R2077:Senp6	UTSW	9	80126155	missense	probably benign	0.14
R2141:Senp6	UTSW	9	80123820	missense	probably damaging	1.00
R2321:Senp6	UTSW	9	80123740	missense	possibly damaging	0.83
R2760:Senp6	UTSW	9	80121978	missense	probably null
R2939:Senp6	UTSW	9	80143842	missense	probably benign	0.00
R2940:Senp6	UTSW	9	80143842	missense	probably benign	0.00
R3081:Senp6	UTSW	9	80143842	missense	probably benign	0.00
R3784:Senp6	UTSW	9	80092286	missense	probably benign	0.16
R3785:Senp6	UTSW	9	80092286	missense	probably benign	0.16
R3800:Senp6	UTSW	9	80087453	missense	possibly damaging	0.89
R3857:Senp6	UTSW	9	80092321	missense	possibly damaging	0.85
R4790:Senp6	UTSW	9	80089858	missense	probably benign	0.20
R5117:Senp6	UTSW	9	80130746	missense	probably damaging	1.00
R5418:Senp6	UTSW	9	80121869	missense	possibly damaging	0.89
R5477:Senp6	UTSW	9	80143843	missense	probably damaging	1.00
R5582:Senp6	UTSW	9	80089876	missense	possibly damaging	0.91
R5717:Senp6	UTSW	9	80092312	missense	probably damaging	0.99
R5800:Senp6	UTSW	9	80126433	missense	probably damaging	1.00
R5802:Senp6	UTSW	9	80118644	unclassified	probably benign
R5899:Senp6	UTSW	9	80142070	splice site	probably benign
R5918:Senp6	UTSW	9	80114116	critical splice donor site	probably null
R5958:Senp6	UTSW	9	80142294	missense	probably damaging	1.00
R6477:Senp6	UTSW	9	80093625	nonsense	probably null
R6628:Senp6	UTSW	9	80132954	missense	probably damaging	1.00
R6703:Senp6	UTSW	9	80121921	missense	probably damaging	1.00
R7236:Senp6	UTSW	9	80132965	missense	probably damaging	1.00
R7268:Senp6	UTSW	9	80142124	missense	probably damaging	1.00
R7290:Senp6	UTSW	9	80136515	missense	probably benign	0.25
R7319:Senp6	UTSW	9	80126199	missense	probably damaging	1.00
R7422:Senp6	UTSW	9	80113877	missense	probably damaging	1.00
R7474:Senp6	UTSW	9	80142328	missense	probably damaging	1.00
R7480:Senp6	UTSW	9	80121917	missense	probably damaging	1.00
R7491:Senp6	UTSW	9	80123728	nonsense	probably null
R8428:Senp6	UTSW	9	80118512	missense	probably damaging	1.00
R8920:Senp6	UTSW	9	80092279	missense	probably benign	0.06
R9158:Senp6	UTSW	9	80087450	missense	probably benign	0.03
R9300:Senp6	UTSW	9	80142151	missense	probably damaging	1.00
R9347:Senp6	UTSW	9	80139097	missense	possibly damaging	0.89
R9387:Senp6	UTSW	9	80092364	missense	probably damaging	1.00
R9521:Senp6	UTSW	9	80067405	start gained	probably benign
R9652:Senp6	UTSW	9	80113946	missense	probably damaging	1.00
R9794:Senp6	UTSW	9	80092308	missense	probably benign	0.04
Z1176:Senp6	UTSW	9	80142266	missense	probably benign	0.02
Z1177:Senp6	UTSW	9	80103693	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- TTCTGGGCCAGATAATTGAGTG -3'
(R):5'- ATCACAGGTGACCAAAATATCAATTG -3'

Sequencing Primer
(F):5'- GCTGGTCTTGAACTCACAGAGATC -3'
(R):5'- GGAATCTTATCCACACTGTTCCC -3'

Posted On

2018-04-27