Incidental Mutation 'R6360:Fyn'
ID513076
Institutional Source Beutler Lab
Gene Symbol Fyn
Ensembl Gene ENSMUSG00000019843
Gene NameFyn proto-oncogene
SynonymsSrc Kinase p59
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6360 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location39368855-39565381 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 39526883 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 217 (T217K)
Ref Sequence ENSEMBL: ENSMUSP00000114188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063091] [ENSMUST00000099967] [ENSMUST00000126486] [ENSMUST00000135242] [ENSMUST00000136659] [ENSMUST00000146287]
Predicted Effect possibly damaging
Transcript: ENSMUST00000063091
AA Change: T217K

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000057707
Gene: ENSMUSG00000019843
AA Change: T217K

DomainStartEndE-ValueType
SH3 85 142 4.21e-24 SMART
SH2 147 237 3.86e-34 SMART
TyrKc 268 517 8.07e-133 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000099967
AA Change: T217K

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000097547
Gene: ENSMUSG00000019843
AA Change: T217K

DomainStartEndE-ValueType
SH3 85 142 4.21e-24 SMART
SH2 147 237 1.65e-33 SMART
TyrKc 271 520 1.08e-133 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000126486
AA Change: T217K

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000115233
Gene: ENSMUSG00000019843
AA Change: T217K

DomainStartEndE-ValueType
SH3 85 142 4.21e-24 SMART
SH2 147 237 3.86e-34 SMART
TyrKc 268 517 8.07e-133 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000135242
AA Change: T217K

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000117111
Gene: ENSMUSG00000019843
AA Change: T217K

DomainStartEndE-ValueType
SH3 85 142 4.21e-24 SMART
SH2 147 237 3.86e-34 SMART
TyrKc 268 517 8.07e-133 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000136659
AA Change: T217K

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000118131
Gene: ENSMUSG00000019843
AA Change: T217K

DomainStartEndE-ValueType
SH3 85 142 4.21e-24 SMART
SH2 147 237 4.37e-33 SMART
TyrKc 222 465 7.5e-119 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000146287
AA Change: T217K

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114188
Gene: ENSMUSG00000019843
AA Change: T217K

DomainStartEndE-ValueType
SH3 85 142 4.21e-24 SMART
SH2 147 237 3.86e-34 SMART
TyrKc 268 517 8.07e-133 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protein-tyrosine kinase oncogene family. It encodes a membrane-associated tyrosine kinase that has been implicated in the control of cell growth. The protein associates with the p85 subunit of phosphatidylinositol 3-kinase and interacts with the fyn-binding protein. Alternatively spliced transcript variants encoding distinct isoforms exist. [provided by RefSeq, Jul 2008]
PHENOTYPE: Different targeted allele homozygotes show different defects, including seizure susceptibility, anxiety, impaired suckling, myelination, LTP and spatial learning, and defects in immune system, circadian rhythm, testes weight and olfactory bulb formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap10 G A 8: 77,259,202 Q657* probably null Het
Car15 T C 16: 17,838,066 T560A probably benign Het
Cass4 C T 2: 172,432,611 H769Y probably damaging Het
Cdh6 A G 15: 13,041,460 I506T possibly damaging Het
Clstn3 G T 6: 124,438,429 R659S possibly damaging Het
Cntnap5b C T 1: 100,431,736 R695* probably null Het
Cpsf1 CCCCTGCATGAGGCAGGTCCC CCCC 15: 76,597,455 probably null Het
Dab2ip A G 2: 35,710,266 H355R probably benign Het
Dennd2a C T 6: 39,493,142 A539T probably benign Het
Dnajc18 T C 18: 35,686,709 E173G probably damaging Het
Dock7 T C 4: 98,969,662 I1472V probably benign Het
Esco1 A T 18: 10,574,931 F714I probably damaging Het
Fam107a T G 14: 8,299,619 H73P probably damaging Het
Fam46b T C 4: 133,486,756 F313L probably damaging Het
Flg A G 3: 93,290,601 probably benign Het
Gbp9 T C 5: 105,083,730 D330G probably benign Het
Gin1 T C 1: 97,792,539 S509P possibly damaging Het
Gm15922 A T 7: 3,736,504 L455Q probably damaging Het
Gm17067 A C 7: 42,708,482 S199A probably benign Het
Grk4 A T 5: 34,674,537 K50M probably damaging Het
Inpp4b A G 8: 81,902,852 H272R probably benign Het
Ipo7 T A 7: 110,027,129 L48Q probably damaging Het
Kbtbd2 A G 6: 56,779,206 I515T probably damaging Het
Kcnu1 T A 8: 25,861,180 S190R possibly damaging Het
Kpnb1 T C 11: 97,173,270 N336S probably benign Het
Lbr G T 1: 181,832,155 D158E probably benign Het
Mphosph10 T C 7: 64,389,955 Q89R probably benign Het
Nectin3 T A 16: 46,411,109 T21S probably benign Het
Numb C A 12: 83,797,262 R383L probably damaging Het
Olfr1370 A T 13: 21,072,583 N239K probably damaging Het
Olfr461 G T 6: 40,544,713 Q89K possibly damaging Het
Park2 T C 17: 12,004,052 F363S probably damaging Het
Pcdhb11 A T 18: 37,422,159 I181F probably benign Het
Pcgf2 T A 11: 97,692,409 probably null Het
Pdzd8 T C 19: 59,300,983 T662A probably benign Het
Pex13 A C 11: 23,655,690 V180G probably benign Het
Pkp4 T A 2: 59,214,747 V22D probably benign Het
Ppp1r32 T C 19: 10,479,481 N167D probably damaging Het
Prpf4b A C 13: 34,901,433 D954A probably damaging Het
Rfx8 T C 1: 39,680,965 I317V probably benign Het
Rnaseh2b T C 14: 62,361,419 S198P probably damaging Het
Rock1 A T 18: 10,116,778 C453S possibly damaging Het
Scarf1 G T 11: 75,515,669 G260W probably damaging Het
Scyl1 T C 19: 5,760,571 E538G probably damaging Het
Sec14l5 A T 16: 5,172,995 I267F probably damaging Het
Senp6 T A 9: 80,113,806 V256D probably benign Het
Sf3b4 G A 3: 96,176,728 probably benign Het
Ssh1 T C 5: 113,961,347 probably null Het
Tas2r143 A C 6: 42,400,835 M200L probably benign Het
Tbc1d22a C T 15: 86,214,629 P19S probably damaging Het
Tmc5 T A 7: 118,633,966 M1K probably null Het
Tnc T C 4: 64,000,733 Y1151C probably damaging Het
Tshz3 A G 7: 36,769,441 E285G probably damaging Het
Txndc11 C T 16: 11,084,792 V664M probably damaging Het
Ube2g1 A T 11: 72,663,082 N20Y probably damaging Het
Ufl1 T A 4: 25,265,476 I369L probably benign Het
Vwf A T 6: 125,683,526 T2666S probably benign Het
Yif1a A G 19: 5,092,341 M259V probably benign Het
Zbtb46 T C 2: 181,391,455 D471G probably damaging Het
Other mutations in Fyn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01988:Fyn APN 10 39533921 nonsense probably null
IGL02626:Fyn APN 10 39526802 missense probably damaging 1.00
H8562:Fyn UTSW 10 39511954 missense probably benign 0.00
R0128:Fyn UTSW 10 39511982 missense probably benign 0.00
R0130:Fyn UTSW 10 39511982 missense probably benign 0.00
R0336:Fyn UTSW 10 39526901 missense possibly damaging 0.52
R1446:Fyn UTSW 10 39522779 missense probably benign 0.43
R1498:Fyn UTSW 10 39532124 missense possibly damaging 0.90
R1539:Fyn UTSW 10 39532070 missense possibly damaging 0.94
R1912:Fyn UTSW 10 39526832 missense possibly damaging 0.94
R2198:Fyn UTSW 10 39529545 missense probably benign 0.13
R2339:Fyn UTSW 10 39522785 missense probably benign 0.00
R3107:Fyn UTSW 10 39551455 missense probably damaging 1.00
R3109:Fyn UTSW 10 39551455 missense probably damaging 1.00
R5068:Fyn UTSW 10 39526843 missense probably damaging 1.00
R5233:Fyn UTSW 10 39529940 missense probably benign
R5929:Fyn UTSW 10 39551461 missense probably damaging 1.00
R6379:Fyn UTSW 10 39455074 start gained probably benign
R6490:Fyn UTSW 10 39551402 missense probably damaging 1.00
R7179:Fyn UTSW 10 39532124 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- ACATAAATGAGGCCTGCAGAGC -3'
(R):5'- ATCCTATCTGGGGCAGAAGAGC -3'

Sequencing Primer
(F):5'- TGCAGAGCAGACTGGGGC -3'
(R):5'- GAACCCCGGACTCCATCTGTC -3'
Posted On2018-04-27