Incidental Mutation 'R6360:Pex13'
ID 513077
Institutional Source Beutler Lab
Gene Symbol Pex13
Ensembl Gene ENSMUSG00000020283
Gene Name peroxisomal biogenesis factor 13
Synonyms
MMRRC Submission 044510-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6360 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 23646479-23665959 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 23655690 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 180 (V180G)
Ref Sequence ENSEMBL: ENSMUSP00000020523 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020523] [ENSMUST00000130811]
AlphaFold Q9D0K1
PDB Structure Solution structure of the SH3 domain of mouse peroxisomal biogenesis factor 13 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000020523
AA Change: V180G

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000020523
Gene: ENSMUSG00000020283
AA Change: V180G

DomainStartEndE-ValueType
low complexity region 5 11 N/A INTRINSIC
low complexity region 18 30 N/A INTRINSIC
Pfam:Peroxin-13_N 101 256 3.6e-51 PFAM
SH3 277 337 1.42e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124839
Predicted Effect probably benign
Transcript: ENSMUST00000130811
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146533
Meta Mutation Damage Score 0.7283 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a peroxisomal membrane protein that binds the type 1 peroxisomal targeting signal receptor via a SH3 domain located in the cytoplasm. Mutations and deficiencies in peroxisomal protein importing and peroxisome assembly lead to peroxisomal biogenesis disorders, an example of which is Zellweger syndrome. [provided by RefSeq, Oct 2008]
PHENOTYPE: Targeted disruption of this gene results in intrauterine growth retardation, hypotonia, aphagia, abnormal lamination of the cerebral cortex associated with a neuronal migration defect, liver steatosis, delayed differentiation of renal glomeruli, impairedperoxisome metabolism, and neonatal death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap10 G A 8: 77,259,202 Q657* probably null Het
Car15 T C 16: 17,838,066 T560A probably benign Het
Cass4 C T 2: 172,432,611 H769Y probably damaging Het
Cdh6 A G 15: 13,041,460 I506T possibly damaging Het
Clstn3 G T 6: 124,438,429 R659S possibly damaging Het
Cntnap5b C T 1: 100,431,736 R695* probably null Het
Cpsf1 CCCCTGCATGAGGCAGGTCCC CCCC 15: 76,597,455 probably null Het
Dab2ip A G 2: 35,710,266 H355R probably benign Het
Dennd2a C T 6: 39,493,142 A539T probably benign Het
Dnajc18 T C 18: 35,686,709 E173G probably damaging Het
Dock7 T C 4: 98,969,662 I1472V probably benign Het
Esco1 A T 18: 10,574,931 F714I probably damaging Het
Fam107a T G 14: 8,299,619 H73P probably damaging Het
Fam46b T C 4: 133,486,756 F313L probably damaging Het
Flg A G 3: 93,290,601 probably benign Het
Fyn C A 10: 39,526,883 T217K possibly damaging Het
Gbp9 T C 5: 105,083,730 D330G probably benign Het
Gin1 T C 1: 97,792,539 S509P possibly damaging Het
Gm15922 A T 7: 3,736,504 L455Q probably damaging Het
Gm17067 A C 7: 42,708,482 S199A probably benign Het
Grk4 A T 5: 34,674,537 K50M probably damaging Het
Inpp4b A G 8: 81,902,852 H272R probably benign Het
Ipo7 T A 7: 110,027,129 L48Q probably damaging Het
Kbtbd2 A G 6: 56,779,206 I515T probably damaging Het
Kcnu1 T A 8: 25,861,180 S190R possibly damaging Het
Kpnb1 T C 11: 97,173,270 N336S probably benign Het
Lbr G T 1: 181,832,155 D158E probably benign Het
Mphosph10 T C 7: 64,389,955 Q89R probably benign Het
Nectin3 T A 16: 46,411,109 T21S probably benign Het
Numb C A 12: 83,797,262 R383L probably damaging Het
Olfr1370 A T 13: 21,072,583 N239K probably damaging Het
Olfr461 G T 6: 40,544,713 Q89K possibly damaging Het
Park2 T C 17: 12,004,052 F363S probably damaging Het
Pcdhb11 A T 18: 37,422,159 I181F probably benign Het
Pcgf2 T A 11: 97,692,409 probably null Het
Pdzd8 T C 19: 59,300,983 T662A probably benign Het
Pkp4 T A 2: 59,214,747 V22D probably benign Het
Ppp1r32 T C 19: 10,479,481 N167D probably damaging Het
Prpf4b A C 13: 34,901,433 D954A probably damaging Het
Rfx8 T C 1: 39,680,965 I317V probably benign Het
Rnaseh2b T C 14: 62,361,419 S198P probably damaging Het
Rock1 A T 18: 10,116,778 C453S possibly damaging Het
Scarf1 G T 11: 75,515,669 G260W probably damaging Het
Scyl1 T C 19: 5,760,571 E538G probably damaging Het
Sec14l5 A T 16: 5,172,995 I267F probably damaging Het
Senp6 T A 9: 80,113,806 V256D probably benign Het
Sf3b4 G A 3: 96,176,728 probably benign Het
Ssh1 T C 5: 113,961,347 probably null Het
Tas2r143 A C 6: 42,400,835 M200L probably benign Het
Tbc1d22a C T 15: 86,214,629 P19S probably damaging Het
Tmc5 T A 7: 118,633,966 M1K probably null Het
Tnc T C 4: 64,000,733 Y1151C probably damaging Het
Tshz3 A G 7: 36,769,441 E285G probably damaging Het
Txndc11 C T 16: 11,084,792 V664M probably damaging Het
Ube2g1 A T 11: 72,663,082 N20Y probably damaging Het
Ufl1 T A 4: 25,265,476 I369L probably benign Het
Vwf A T 6: 125,683,526 T2666S probably benign Het
Yif1a A G 19: 5,092,341 M259V probably benign Het
Zbtb46 T C 2: 181,391,455 D471G probably damaging Het
Other mutations in Pex13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01527:Pex13 APN 11 23656111 missense probably benign
Pitch UTSW 11 23655949 missense probably benign
yaw UTSW 11 23649527 missense possibly damaging 0.58
R0455:Pex13 UTSW 11 23655949 missense probably benign
R0671:Pex13 UTSW 11 23665831 missense possibly damaging 0.57
R1454:Pex13 UTSW 11 23649422 missense probably benign
R1738:Pex13 UTSW 11 23649458 missense probably benign
R1830:Pex13 UTSW 11 23655513 missense probably damaging 0.96
R2349:Pex13 UTSW 11 23655789 missense probably damaging 0.96
R4688:Pex13 UTSW 11 23655472 missense possibly damaging 0.69
R5094:Pex13 UTSW 11 23655441 missense probably benign 0.00
R5727:Pex13 UTSW 11 23655705 missense probably benign 0.02
R6837:Pex13 UTSW 11 23649527 missense possibly damaging 0.58
R6957:Pex13 UTSW 11 23655628 missense probably benign
R7167:Pex13 UTSW 11 23655472 missense possibly damaging 0.69
R7880:Pex13 UTSW 11 23649369 missense probably benign 0.26
R7898:Pex13 UTSW 11 23650929 critical splice donor site probably null
R8000:Pex13 UTSW 11 23655915 missense probably damaging 1.00
R8284:Pex13 UTSW 11 23655685 missense possibly damaging 0.69
R9086:Pex13 UTSW 11 23665760 missense probably damaging 1.00
R9334:Pex13 UTSW 11 23655630 missense probably benign 0.04
R9415:Pex13 UTSW 11 23651034 missense probably damaging 1.00
R9743:Pex13 UTSW 11 23656119 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAAGGACCGCCAAGGATAAC -3'
(R):5'- CCAGTAGGTTTGTTCAGCAAGC -3'

Sequencing Primer
(F):5'- CAGGAATATTGGCCAAGATTTTGCTG -3'
(R):5'- CAGCAAGCTGAAGAAAGCAG -3'
Posted On 2018-04-27