Incidental Mutation 'R6360:Scarf1'
ID513079
Institutional Source Beutler Lab
Gene Symbol Scarf1
Ensembl Gene ENSMUSG00000038188
Gene Namescavenger receptor class F, member 1
SynonymsSREC-I, SREC
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6360 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location75513540-75526582 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 75515669 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Tryptophan at position 260 (G260W)
Ref Sequence ENSEMBL: ENSMUSP00000114090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042808] [ENSMUST00000042972] [ENSMUST00000118243] [ENSMUST00000123819]
Predicted Effect probably damaging
Transcript: ENSMUST00000042808
AA Change: G260W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044248
Gene: ENSMUSG00000038188
AA Change: G260W

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 54 90 2.16e1 SMART
EGF 101 133 1.36e1 SMART
EGF_like 165 193 4.55e1 SMART
EGF_Lam 225 263 8.78e-2 SMART
EGF_like 262 296 4.93e1 SMART
EGF 307 341 2.69e1 SMART
EGF 352 384 2.25e1 SMART
transmembrane domain 424 446 N/A INTRINSIC
low complexity region 520 535 N/A INTRINSIC
low complexity region 791 805 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000042972
SMART Domains Protein: ENSMUSP00000037238
Gene: ENSMUSG00000038195

DomainStartEndE-ValueType
low complexity region 14 24 N/A INTRINSIC
Pfam:Jnk-SapK_ap_N 27 195 2.1e-16 PFAM
Pfam:RILP 223 281 1.1e-21 PFAM
low complexity region 289 298 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118243
AA Change: G260W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114090
Gene: ENSMUSG00000038188
AA Change: G260W

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 54 90 2.16e1 SMART
EGF 101 133 1.36e1 SMART
EGF_like 165 193 4.55e1 SMART
EGF_Lam 225 263 8.78e-2 SMART
EGF_like 262 296 4.93e1 SMART
EGF 307 341 2.69e1 SMART
EGF 352 384 2.25e1 SMART
transmembrane domain 424 446 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123819
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156923
Meta Mutation Damage Score 0.5390 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a scavenger receptor that is expressed in endothelial cells. It regulates the uptake of chemically modified low density lipoproteins, including acetylated low density lipoprotein (Ac-LDL), and it may be involved in atherogenesis. This gene is regulated by the transcription factors ZNF444/EZF-2 and SP1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygous null mice are viable and fertile with no abnormalities detected in plasma glucose, cholesterol, or triglycerides, or in the brain, lung, heart, kidney, liver, or testes. Mice homozygous for a targeted allele exhibit impaired clearance of apoptotic cells and autoimmune disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap10 G A 8: 77,259,202 Q657* probably null Het
Car15 T C 16: 17,838,066 T560A probably benign Het
Cass4 C T 2: 172,432,611 H769Y probably damaging Het
Cdh6 A G 15: 13,041,460 I506T possibly damaging Het
Clstn3 G T 6: 124,438,429 R659S possibly damaging Het
Cntnap5b C T 1: 100,431,736 R695* probably null Het
Cpsf1 CCCCTGCATGAGGCAGGTCCC CCCC 15: 76,597,455 probably null Het
Dab2ip A G 2: 35,710,266 H355R probably benign Het
Dennd2a C T 6: 39,493,142 A539T probably benign Het
Dnajc18 T C 18: 35,686,709 E173G probably damaging Het
Dock7 T C 4: 98,969,662 I1472V probably benign Het
Esco1 A T 18: 10,574,931 F714I probably damaging Het
Fam107a T G 14: 8,299,619 H73P probably damaging Het
Fam46b T C 4: 133,486,756 F313L probably damaging Het
Flg A G 3: 93,290,601 probably benign Het
Fyn C A 10: 39,526,883 T217K possibly damaging Het
Gbp9 T C 5: 105,083,730 D330G probably benign Het
Gin1 T C 1: 97,792,539 S509P possibly damaging Het
Gm15922 A T 7: 3,736,504 L455Q probably damaging Het
Gm17067 A C 7: 42,708,482 S199A probably benign Het
Grk4 A T 5: 34,674,537 K50M probably damaging Het
Inpp4b A G 8: 81,902,852 H272R probably benign Het
Ipo7 T A 7: 110,027,129 L48Q probably damaging Het
Kbtbd2 A G 6: 56,779,206 I515T probably damaging Het
Kcnu1 T A 8: 25,861,180 S190R possibly damaging Het
Kpnb1 T C 11: 97,173,270 N336S probably benign Het
Lbr G T 1: 181,832,155 D158E probably benign Het
Mphosph10 T C 7: 64,389,955 Q89R probably benign Het
Nectin3 T A 16: 46,411,109 T21S probably benign Het
Numb C A 12: 83,797,262 R383L probably damaging Het
Olfr1370 A T 13: 21,072,583 N239K probably damaging Het
Olfr461 G T 6: 40,544,713 Q89K possibly damaging Het
Park2 T C 17: 12,004,052 F363S probably damaging Het
Pcdhb11 A T 18: 37,422,159 I181F probably benign Het
Pcgf2 T A 11: 97,692,409 probably null Het
Pdzd8 T C 19: 59,300,983 T662A probably benign Het
Pex13 A C 11: 23,655,690 V180G probably benign Het
Pkp4 T A 2: 59,214,747 V22D probably benign Het
Ppp1r32 T C 19: 10,479,481 N167D probably damaging Het
Prpf4b A C 13: 34,901,433 D954A probably damaging Het
Rfx8 T C 1: 39,680,965 I317V probably benign Het
Rnaseh2b T C 14: 62,361,419 S198P probably damaging Het
Rock1 A T 18: 10,116,778 C453S possibly damaging Het
Scyl1 T C 19: 5,760,571 E538G probably damaging Het
Sec14l5 A T 16: 5,172,995 I267F probably damaging Het
Senp6 T A 9: 80,113,806 V256D probably benign Het
Sf3b4 G A 3: 96,176,728 probably benign Het
Ssh1 T C 5: 113,961,347 probably null Het
Tas2r143 A C 6: 42,400,835 M200L probably benign Het
Tbc1d22a C T 15: 86,214,629 P19S probably damaging Het
Tmc5 T A 7: 118,633,966 M1K probably null Het
Tnc T C 4: 64,000,733 Y1151C probably damaging Het
Tshz3 A G 7: 36,769,441 E285G probably damaging Het
Txndc11 C T 16: 11,084,792 V664M probably damaging Het
Ube2g1 A T 11: 72,663,082 N20Y probably damaging Het
Ufl1 T A 4: 25,265,476 I369L probably benign Het
Vwf A T 6: 125,683,526 T2666S probably benign Het
Yif1a A G 19: 5,092,341 M259V probably benign Het
Zbtb46 T C 2: 181,391,455 D471G probably damaging Het
Other mutations in Scarf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01695:Scarf1 APN 11 75521957 missense probably damaging 0.98
IGL02968:Scarf1 APN 11 75524089 missense probably damaging 1.00
R0078:Scarf1 UTSW 11 75515162 splice site probably benign
R0606:Scarf1 UTSW 11 75514348 missense probably damaging 0.98
R0834:Scarf1 UTSW 11 75514403 nonsense probably null
R1715:Scarf1 UTSW 11 75524044 missense probably damaging 1.00
R2327:Scarf1 UTSW 11 75526028 missense probably damaging 1.00
R2483:Scarf1 UTSW 11 75515291 missense probably damaging 0.98
R3699:Scarf1 UTSW 11 75514369 missense probably damaging 1.00
R3831:Scarf1 UTSW 11 75515252 missense probably damaging 1.00
R3832:Scarf1 UTSW 11 75515252 missense probably damaging 1.00
R3833:Scarf1 UTSW 11 75515252 missense probably damaging 1.00
R4957:Scarf1 UTSW 11 75525634 missense probably benign 0.10
R4990:Scarf1 UTSW 11 75526015 missense probably benign 0.00
R4992:Scarf1 UTSW 11 75522230 missense probably damaging 1.00
R4992:Scarf1 UTSW 11 75526015 missense probably benign 0.00
R5291:Scarf1 UTSW 11 75524074 missense probably damaging 1.00
R5330:Scarf1 UTSW 11 75515580 missense probably damaging 1.00
R5331:Scarf1 UTSW 11 75515580 missense probably damaging 1.00
R5537:Scarf1 UTSW 11 75525531 missense probably damaging 1.00
R5583:Scarf1 UTSW 11 75514016 missense possibly damaging 0.95
R5592:Scarf1 UTSW 11 75525687 missense probably benign 0.08
R6130:Scarf1 UTSW 11 75525739 missense probably benign
R6289:Scarf1 UTSW 11 75525416 missense possibly damaging 0.83
R6313:Scarf1 UTSW 11 75520315 missense probably benign 0.02
R6944:Scarf1 UTSW 11 75522206 missense probably benign 0.00
R7113:Scarf1 UTSW 11 75526078 missense probably damaging 0.99
R7624:Scarf1 UTSW 11 75514416 splice site probably null
Z1088:Scarf1 UTSW 11 75525490 missense probably damaging 1.00
Z1177:Scarf1 UTSW 11 75515247 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGGAACCTGTGTATGCC -3'
(R):5'- TGGAGATTGCCCCTCAGTACTC -3'

Sequencing Primer
(F):5'- GTTGCAACTGCCACACCTCG -3'
(R):5'- AACAGGGTTTCTCTATATAGCTCTGG -3'
Posted On2018-04-27