Incidental Mutation 'R6360:Kpnb1'
ID513080
Institutional Source Beutler Lab
Gene Symbol Kpnb1
Ensembl Gene ENSMUSG00000001440
Gene Namekaryopherin (importin) beta 1
SynonymsImpnb
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6360 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location97159714-97187881 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 97173270 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 336 (N336S)
Ref Sequence ENSEMBL: ENSMUSP00000001479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001479]
PDB Structure N-TERMINAL FRAGMENT OF IMPORTIN-BETA [X-RAY DIFFRACTION]
Crystal structure of Importin-beta and SREBP-2 complex [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000001479
AA Change: N336S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000001479
Gene: ENSMUSG00000001440
AA Change: N336S

DomainStartEndE-ValueType
IBN_N 21 101 3.72e-5 SMART
Blast:ARM 158 203 4e-7 BLAST
Pfam:HEAT_EZ 380 435 3e-13 PFAM
Pfam:HEAT 409 439 2.6e-7 PFAM
Blast:ARM 440 477 7e-17 BLAST
low complexity region 478 495 N/A INTRINSIC
Blast:IBN_N 528 590 9e-25 BLAST
Blast:ARM 594 637 1e-18 BLAST
Blast:ARM 784 827 1e-5 BLAST
Meta Mutation Damage Score 0.0589 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nucleocytoplasmic transport, a signal- and energy-dependent process, takes place through nuclear pore complexes embedded in the nuclear envelope. The import of proteins containing a nuclear localization signal (NLS) requires the NLS import receptor, a heterodimer of importin alpha and beta subunits also known as karyopherins. Importin alpha binds the NLS-containing cargo in the cytoplasm and importin beta docks the complex at the cytoplasmic side of the nuclear pore complex. In the presence of nucleoside triphosphates and the small GTP binding protein Ran, the complex moves into the nuclear pore complex and the importin subunits dissociate. Importin alpha enters the nucleoplasm with its passenger protein and importin beta remains at the pore. Interactions between importin beta and the FG repeats of nucleoporins are essential in translocation through the pore complex. The protein encoded by this gene is a member of the importin beta family. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2013]
PHENOTYPE: Homozygous mutation of this gene results in lethality shortly after implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap10 G A 8: 77,259,202 Q657* probably null Het
Car15 T C 16: 17,838,066 T560A probably benign Het
Cass4 C T 2: 172,432,611 H769Y probably damaging Het
Cdh6 A G 15: 13,041,460 I506T possibly damaging Het
Clstn3 G T 6: 124,438,429 R659S possibly damaging Het
Cntnap5b C T 1: 100,431,736 R695* probably null Het
Cpsf1 CCCCTGCATGAGGCAGGTCCC CCCC 15: 76,597,455 probably null Het
Dab2ip A G 2: 35,710,266 H355R probably benign Het
Dennd2a C T 6: 39,493,142 A539T probably benign Het
Dnajc18 T C 18: 35,686,709 E173G probably damaging Het
Dock7 T C 4: 98,969,662 I1472V probably benign Het
Esco1 A T 18: 10,574,931 F714I probably damaging Het
Fam107a T G 14: 8,299,619 H73P probably damaging Het
Fam46b T C 4: 133,486,756 F313L probably damaging Het
Flg A G 3: 93,290,601 probably benign Het
Fyn C A 10: 39,526,883 T217K possibly damaging Het
Gbp9 T C 5: 105,083,730 D330G probably benign Het
Gin1 T C 1: 97,792,539 S509P possibly damaging Het
Gm15922 A T 7: 3,736,504 L455Q probably damaging Het
Gm17067 A C 7: 42,708,482 S199A probably benign Het
Grk4 A T 5: 34,674,537 K50M probably damaging Het
Inpp4b A G 8: 81,902,852 H272R probably benign Het
Ipo7 T A 7: 110,027,129 L48Q probably damaging Het
Kbtbd2 A G 6: 56,779,206 I515T probably damaging Het
Kcnu1 T A 8: 25,861,180 S190R possibly damaging Het
Lbr G T 1: 181,832,155 D158E probably benign Het
Mphosph10 T C 7: 64,389,955 Q89R probably benign Het
Nectin3 T A 16: 46,411,109 T21S probably benign Het
Numb C A 12: 83,797,262 R383L probably damaging Het
Olfr1370 A T 13: 21,072,583 N239K probably damaging Het
Olfr461 G T 6: 40,544,713 Q89K possibly damaging Het
Park2 T C 17: 12,004,052 F363S probably damaging Het
Pcdhb11 A T 18: 37,422,159 I181F probably benign Het
Pcgf2 T A 11: 97,692,409 probably null Het
Pdzd8 T C 19: 59,300,983 T662A probably benign Het
Pex13 A C 11: 23,655,690 V180G probably benign Het
Pkp4 T A 2: 59,214,747 V22D probably benign Het
Ppp1r32 T C 19: 10,479,481 N167D probably damaging Het
Prpf4b A C 13: 34,901,433 D954A probably damaging Het
Rfx8 T C 1: 39,680,965 I317V probably benign Het
Rnaseh2b T C 14: 62,361,419 S198P probably damaging Het
Rock1 A T 18: 10,116,778 C453S possibly damaging Het
Scarf1 G T 11: 75,515,669 G260W probably damaging Het
Scyl1 T C 19: 5,760,571 E538G probably damaging Het
Sec14l5 A T 16: 5,172,995 I267F probably damaging Het
Senp6 T A 9: 80,113,806 V256D probably benign Het
Sf3b4 G A 3: 96,176,728 probably benign Het
Ssh1 T C 5: 113,961,347 probably null Het
Tas2r143 A C 6: 42,400,835 M200L probably benign Het
Tbc1d22a C T 15: 86,214,629 P19S probably damaging Het
Tmc5 T A 7: 118,633,966 M1K probably null Het
Tnc T C 4: 64,000,733 Y1151C probably damaging Het
Tshz3 A G 7: 36,769,441 E285G probably damaging Het
Txndc11 C T 16: 11,084,792 V664M probably damaging Het
Ube2g1 A T 11: 72,663,082 N20Y probably damaging Het
Ufl1 T A 4: 25,265,476 I369L probably benign Het
Vwf A T 6: 125,683,526 T2666S probably benign Het
Yif1a A G 19: 5,092,341 M259V probably benign Het
Zbtb46 T C 2: 181,391,455 D471G probably damaging Het
Other mutations in Kpnb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01284:Kpnb1 APN 11 97166102 missense probably damaging 1.00
IGL01919:Kpnb1 APN 11 97164730 missense probably benign
IGL02161:Kpnb1 APN 11 97168936 missense probably benign 0.01
IGL02679:Kpnb1 APN 11 97177260 missense possibly damaging 0.92
IGL02866:Kpnb1 APN 11 97177286 missense probably damaging 0.99
IGL02899:Kpnb1 APN 11 97175786 missense probably damaging 1.00
R0373:Kpnb1 UTSW 11 97185090 missense probably damaging 1.00
R0542:Kpnb1 UTSW 11 97187572 missense probably benign 0.12
R0724:Kpnb1 UTSW 11 97178304 missense probably damaging 1.00
R0825:Kpnb1 UTSW 11 97171675 missense probably damaging 0.98
R0853:Kpnb1 UTSW 11 97187411 missense probably damaging 0.97
R1481:Kpnb1 UTSW 11 97178310 missense probably damaging 1.00
R3802:Kpnb1 UTSW 11 97166129 missense possibly damaging 0.92
R4458:Kpnb1 UTSW 11 97169170 missense probably damaging 1.00
R4490:Kpnb1 UTSW 11 97171598 missense probably benign
R4757:Kpnb1 UTSW 11 97177334 missense possibly damaging 0.65
R5500:Kpnb1 UTSW 11 97173111 missense possibly damaging 0.94
R6494:Kpnb1 UTSW 11 97181648 missense probably benign 0.04
R7678:Kpnb1 UTSW 11 97169173 missense probably damaging 1.00
R8171:Kpnb1 UTSW 11 97175747 critical splice donor site probably null
R8874:Kpnb1 UTSW 11 97165383 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- GCCAAAAGCCATCACTGCTG -3'
(R):5'- CAAGCCTTCTAAGTGAATTCATTGC -3'

Sequencing Primer
(F):5'- ACTGCTGCATCCCGGTATCG -3'
(R):5'- AAAGCTTACTTAGGCTGGGC -3'
Posted On2018-04-27