Incidental Mutation 'R6360:Pcgf2'
ID513081
Institutional Source Beutler Lab
Gene Symbol Pcgf2
Ensembl Gene ENSMUSG00000018537
Gene Namepolycomb group ring finger 2
Synonymsmel-18, Rnf110, Zfp144
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6360 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location97688823-97700497 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 97692409 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099438 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018681] [ENSMUST00000103148] [ENSMUST00000103149] [ENSMUST00000103149] [ENSMUST00000107583] [ENSMUST00000107584] [ENSMUST00000107585] [ENSMUST00000169807] [ENSMUST00000179765]
Predicted Effect probably benign
Transcript: ENSMUST00000018681
AA Change: K92N

PolyPhen 2 Score 0.305 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000018681
Gene: ENSMUSG00000018537
AA Change: K92N

DomainStartEndE-ValueType
RING 18 56 4.99e-5 SMART
low complexity region 263 318 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103148
AA Change: K92N

PolyPhen 2 Score 0.305 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000099437
Gene: ENSMUSG00000018537
AA Change: K92N

DomainStartEndE-ValueType
RING 18 56 4.99e-5 SMART
low complexity region 263 318 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000103149
SMART Domains Protein: ENSMUSP00000099438
Gene: ENSMUSG00000018537

DomainStartEndE-ValueType
low complexity region 79 134 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000103149
SMART Domains Protein: ENSMUSP00000099438
Gene: ENSMUSG00000018537

DomainStartEndE-ValueType
low complexity region 79 134 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107583
SMART Domains Protein: ENSMUSP00000103209
Gene: ENSMUSG00000078695

DomainStartEndE-ValueType
ZnF_CDGSH 54 88 3.39e-9 SMART
ZnF_CDGSH 92 129 5.55e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107584
SMART Domains Protein: ENSMUSP00000103210
Gene: ENSMUSG00000078695

DomainStartEndE-ValueType
ZnF_CDGSH 32 66 3.39e-9 SMART
ZnF_CDGSH 70 107 5.55e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107585
SMART Domains Protein: ENSMUSP00000103211
Gene: ENSMUSG00000078695

DomainStartEndE-ValueType
low complexity region 18 29 N/A INTRINSIC
ZnF_CDGSH 51 85 3.39e-9 SMART
ZnF_CDGSH 89 126 5.55e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126185
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134003
Predicted Effect probably benign
Transcript: ENSMUST00000169807
AA Change: K92N

PolyPhen 2 Score 0.305 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000126967
Gene: ENSMUSG00000018537
AA Change: K92N

DomainStartEndE-ValueType
RING 18 56 4.99e-5 SMART
Pfam:RAWUL 146 228 1.9e-26 PFAM
low complexity region 263 318 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179765
AA Change: K92N

PolyPhen 2 Score 0.305 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000137517
Gene: ENSMUSG00000018537
AA Change: K92N

DomainStartEndE-ValueType
RING 18 56 4.99e-5 SMART
low complexity region 263 318 N/A INTRINSIC
Meta Mutation Damage Score 0.3382 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING finger motif and is similar to the polycomb group (PcG) gene products. PcG gene products form complexes via protein-protein interaction and maintain the transcription repression of genes involved in embryogenesis, cell cycles, and tumorigenesis. This protein was shown to act as a negative regulator of transcription and has tumor suppressor activity. The expression of this gene was detected in various tumor cells, but is limited in neural organs in normal tissues. Knockout studies in mice suggested that this protein may negatively regulate the expression of different cytokines, chemokines, and chemokine receptors, and thus plays an important role in lymphocyte differentiation and migration, as well as in immune responses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit multiple abnormalities of the axial skeleton (including homeotic transformations), grow markedly slower, and die either perinatally or between 3-6 weeks of age depending on genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap10 G A 8: 77,259,202 Q657* probably null Het
Car15 T C 16: 17,838,066 T560A probably benign Het
Cass4 C T 2: 172,432,611 H769Y probably damaging Het
Cdh6 A G 15: 13,041,460 I506T possibly damaging Het
Clstn3 G T 6: 124,438,429 R659S possibly damaging Het
Cntnap5b C T 1: 100,431,736 R695* probably null Het
Cpsf1 CCCCTGCATGAGGCAGGTCCC CCCC 15: 76,597,455 probably null Het
Dab2ip A G 2: 35,710,266 H355R probably benign Het
Dennd2a C T 6: 39,493,142 A539T probably benign Het
Dnajc18 T C 18: 35,686,709 E173G probably damaging Het
Dock7 T C 4: 98,969,662 I1472V probably benign Het
Esco1 A T 18: 10,574,931 F714I probably damaging Het
Fam107a T G 14: 8,299,619 H73P probably damaging Het
Fam46b T C 4: 133,486,756 F313L probably damaging Het
Flg A G 3: 93,290,601 probably benign Het
Fyn C A 10: 39,526,883 T217K possibly damaging Het
Gbp9 T C 5: 105,083,730 D330G probably benign Het
Gin1 T C 1: 97,792,539 S509P possibly damaging Het
Gm15922 A T 7: 3,736,504 L455Q probably damaging Het
Gm17067 A C 7: 42,708,482 S199A probably benign Het
Grk4 A T 5: 34,674,537 K50M probably damaging Het
Inpp4b A G 8: 81,902,852 H272R probably benign Het
Ipo7 T A 7: 110,027,129 L48Q probably damaging Het
Kbtbd2 A G 6: 56,779,206 I515T probably damaging Het
Kcnu1 T A 8: 25,861,180 S190R possibly damaging Het
Kpnb1 T C 11: 97,173,270 N336S probably benign Het
Lbr G T 1: 181,832,155 D158E probably benign Het
Mphosph10 T C 7: 64,389,955 Q89R probably benign Het
Nectin3 T A 16: 46,411,109 T21S probably benign Het
Numb C A 12: 83,797,262 R383L probably damaging Het
Olfr1370 A T 13: 21,072,583 N239K probably damaging Het
Olfr461 G T 6: 40,544,713 Q89K possibly damaging Het
Park2 T C 17: 12,004,052 F363S probably damaging Het
Pcdhb11 A T 18: 37,422,159 I181F probably benign Het
Pdzd8 T C 19: 59,300,983 T662A probably benign Het
Pex13 A C 11: 23,655,690 V180G probably benign Het
Pkp4 T A 2: 59,214,747 V22D probably benign Het
Ppp1r32 T C 19: 10,479,481 N167D probably damaging Het
Prpf4b A C 13: 34,901,433 D954A probably damaging Het
Rfx8 T C 1: 39,680,965 I317V probably benign Het
Rnaseh2b T C 14: 62,361,419 S198P probably damaging Het
Rock1 A T 18: 10,116,778 C453S possibly damaging Het
Scarf1 G T 11: 75,515,669 G260W probably damaging Het
Scyl1 T C 19: 5,760,571 E538G probably damaging Het
Sec14l5 A T 16: 5,172,995 I267F probably damaging Het
Senp6 T A 9: 80,113,806 V256D probably benign Het
Sf3b4 G A 3: 96,176,728 probably benign Het
Ssh1 T C 5: 113,961,347 probably null Het
Tas2r143 A C 6: 42,400,835 M200L probably benign Het
Tbc1d22a C T 15: 86,214,629 P19S probably damaging Het
Tmc5 T A 7: 118,633,966 M1K probably null Het
Tnc T C 4: 64,000,733 Y1151C probably damaging Het
Tshz3 A G 7: 36,769,441 E285G probably damaging Het
Txndc11 C T 16: 11,084,792 V664M probably damaging Het
Ube2g1 A T 11: 72,663,082 N20Y probably damaging Het
Ufl1 T A 4: 25,265,476 I369L probably benign Het
Vwf A T 6: 125,683,526 T2666S probably benign Het
Yif1a A G 19: 5,092,341 M259V probably benign Het
Zbtb46 T C 2: 181,391,455 D471G probably damaging Het
Other mutations in Pcgf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Pcgf2 APN 11 97690240 missense probably benign 0.01
IGL01877:Pcgf2 APN 11 97692533 missense probably damaging 1.00
IGL02473:Pcgf2 APN 11 97691921 splice site probably benign
R0243:Pcgf2 UTSW 11 97692418 unclassified probably null
R0522:Pcgf2 UTSW 11 97692047 missense probably benign 0.31
R0712:Pcgf2 UTSW 11 97691004 missense probably damaging 1.00
R0781:Pcgf2 UTSW 11 97691850 splice site probably benign
R1110:Pcgf2 UTSW 11 97691850 splice site probably benign
R4295:Pcgf2 UTSW 11 97693456 nonsense probably null
R4959:Pcgf2 UTSW 11 97691689 missense possibly damaging 0.85
R5569:Pcgf2 UTSW 11 97692367 critical splice donor site probably null
R5622:Pcgf2 UTSW 11 97690252 missense probably damaging 1.00
R5779:Pcgf2 UTSW 11 97690291 missense probably damaging 1.00
R6001:Pcgf2 UTSW 11 97692780 missense possibly damaging 0.91
R6090:Pcgf2 UTSW 11 97690991 missense possibly damaging 0.71
Z1176:Pcgf2 UTSW 11 97690021 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGACAGTACTGTAGCTGGG -3'
(R):5'- AAGGGGTACAGAGCTGATCC -3'

Sequencing Primer
(F):5'- ACAGTACTGTAGCTGGGAGATCTG -3'
(R):5'- ACCCGTGGTTGCTAATGC -3'
Posted On2018-04-27