Incidental Mutation 'R6360:Cdh6'
ID513088
Institutional Source Beutler Lab
Gene Symbol Cdh6
Ensembl Gene ENSMUSG00000039385
Gene Namecadherin 6
Synonymscad6, K-cadherin
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.612) question?
Stock #R6360 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location13028701-13173675 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13041460 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 506 (I506T)
Ref Sequence ENSEMBL: ENSMUSP00000037113 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036439]
PDB Structure
Crystal structure of cadherin-6 EC12 W4A [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036439
AA Change: I506T

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000037113
Gene: ENSMUSG00000039385
AA Change: I506T

DomainStartEndE-ValueType
CA 76 157 7e-15 SMART
CA 181 266 9.06e-32 SMART
CA 290 382 1.14e-19 SMART
CA 405 486 8.81e-21 SMART
CA 509 596 2.82e-10 SMART
transmembrane domain 614 636 N/A INTRINSIC
Pfam:Cadherin_C 639 783 5.6e-57 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. Mice lacking the encoded protein exhibit delay in mesenchyme-to-epithelial conversion and a loss of nephrons. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 15. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit delayed mesenchyme to epithelial conversion and loss of nephrons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap10 G A 8: 77,259,202 Q657* probably null Het
Car15 T C 16: 17,838,066 T560A probably benign Het
Cass4 C T 2: 172,432,611 H769Y probably damaging Het
Clstn3 G T 6: 124,438,429 R659S possibly damaging Het
Cntnap5b C T 1: 100,431,736 R695* probably null Het
Cpsf1 CCCCTGCATGAGGCAGGTCCC CCCC 15: 76,597,455 probably null Het
Dab2ip A G 2: 35,710,266 H355R probably benign Het
Dennd2a C T 6: 39,493,142 A539T probably benign Het
Dnajc18 T C 18: 35,686,709 E173G probably damaging Het
Dock7 T C 4: 98,969,662 I1472V probably benign Het
Esco1 A T 18: 10,574,931 F714I probably damaging Het
Fam107a T G 14: 8,299,619 H73P probably damaging Het
Fam46b T C 4: 133,486,756 F313L probably damaging Het
Flg A G 3: 93,290,601 probably benign Het
Fyn C A 10: 39,526,883 T217K possibly damaging Het
Gbp9 T C 5: 105,083,730 D330G probably benign Het
Gin1 T C 1: 97,792,539 S509P possibly damaging Het
Gm15922 A T 7: 3,736,504 L455Q probably damaging Het
Gm17067 A C 7: 42,708,482 S199A probably benign Het
Grk4 A T 5: 34,674,537 K50M probably damaging Het
Inpp4b A G 8: 81,902,852 H272R probably benign Het
Ipo7 T A 7: 110,027,129 L48Q probably damaging Het
Kbtbd2 A G 6: 56,779,206 I515T probably damaging Het
Kcnu1 T A 8: 25,861,180 S190R possibly damaging Het
Kpnb1 T C 11: 97,173,270 N336S probably benign Het
Lbr G T 1: 181,832,155 D158E probably benign Het
Mphosph10 T C 7: 64,389,955 Q89R probably benign Het
Nectin3 T A 16: 46,411,109 T21S probably benign Het
Numb C A 12: 83,797,262 R383L probably damaging Het
Olfr1370 A T 13: 21,072,583 N239K probably damaging Het
Olfr461 G T 6: 40,544,713 Q89K possibly damaging Het
Park2 T C 17: 12,004,052 F363S probably damaging Het
Pcdhb11 A T 18: 37,422,159 I181F probably benign Het
Pcgf2 T A 11: 97,692,409 probably null Het
Pdzd8 T C 19: 59,300,983 T662A probably benign Het
Pex13 A C 11: 23,655,690 V180G probably benign Het
Pkp4 T A 2: 59,214,747 V22D probably benign Het
Ppp1r32 T C 19: 10,479,481 N167D probably damaging Het
Prpf4b A C 13: 34,901,433 D954A probably damaging Het
Rfx8 T C 1: 39,680,965 I317V probably benign Het
Rnaseh2b T C 14: 62,361,419 S198P probably damaging Het
Rock1 A T 18: 10,116,778 C453S possibly damaging Het
Scarf1 G T 11: 75,515,669 G260W probably damaging Het
Scyl1 T C 19: 5,760,571 E538G probably damaging Het
Sec14l5 A T 16: 5,172,995 I267F probably damaging Het
Senp6 T A 9: 80,113,806 V256D probably benign Het
Sf3b4 G A 3: 96,176,728 probably benign Het
Ssh1 T C 5: 113,961,347 probably null Het
Tas2r143 A C 6: 42,400,835 M200L probably benign Het
Tbc1d22a C T 15: 86,214,629 P19S probably damaging Het
Tmc5 T A 7: 118,633,966 M1K probably null Het
Tnc T C 4: 64,000,733 Y1151C probably damaging Het
Tshz3 A G 7: 36,769,441 E285G probably damaging Het
Txndc11 C T 16: 11,084,792 V664M probably damaging Het
Ube2g1 A T 11: 72,663,082 N20Y probably damaging Het
Ufl1 T A 4: 25,265,476 I369L probably benign Het
Vwf A T 6: 125,683,526 T2666S probably benign Het
Yif1a A G 19: 5,092,341 M259V probably benign Het
Zbtb46 T C 2: 181,391,455 D471G probably damaging Het
Other mutations in Cdh6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00560:Cdh6 APN 15 13034359 nonsense probably null
IGL00675:Cdh6 APN 15 13041439 missense possibly damaging 0.80
IGL01063:Cdh6 APN 15 13064495 missense probably damaging 1.00
IGL01335:Cdh6 APN 15 13051309 missense probably benign 0.40
IGL01351:Cdh6 APN 15 13034240 missense possibly damaging 0.55
IGL02010:Cdh6 APN 15 13034190 utr 3 prime probably benign
IGL02428:Cdh6 APN 15 13064430 missense possibly damaging 0.94
PIT4651001:Cdh6 UTSW 15 13044719 missense possibly damaging 0.69
R0124:Cdh6 UTSW 15 13034324 missense probably damaging 1.00
R0256:Cdh6 UTSW 15 13053782 splice site probably benign
R0696:Cdh6 UTSW 15 13051332 missense probably benign 0.36
R1017:Cdh6 UTSW 15 13051476 missense probably benign 0.06
R1240:Cdh6 UTSW 15 13057455 missense possibly damaging 0.48
R1444:Cdh6 UTSW 15 13091838 missense probably benign 0.00
R2008:Cdh6 UTSW 15 13051476 missense possibly damaging 0.74
R2050:Cdh6 UTSW 15 13057501 missense probably benign
R2507:Cdh6 UTSW 15 13041361 missense probably benign 0.10
R3082:Cdh6 UTSW 15 13044752 missense probably damaging 1.00
R3083:Cdh6 UTSW 15 13044752 missense probably damaging 1.00
R3903:Cdh6 UTSW 15 13042575 missense probably benign 0.39
R4591:Cdh6 UTSW 15 13051486 missense possibly damaging 0.69
R4859:Cdh6 UTSW 15 13051332 missense probably benign 0.36
R4898:Cdh6 UTSW 15 13034688 missense probably damaging 0.99
R5242:Cdh6 UTSW 15 13064411 missense probably benign 0.05
R5313:Cdh6 UTSW 15 13034637 missense probably damaging 1.00
R5545:Cdh6 UTSW 15 13041149 missense probably damaging 1.00
R6650:Cdh6 UTSW 15 13051401 missense probably benign 0.11
R6830:Cdh6 UTSW 15 13044774 missense probably benign 0.01
R7369:Cdh6 UTSW 15 13042638 missense probably damaging 0.99
R7506:Cdh6 UTSW 15 13034310 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGGTGAGTGTGTAGATACTCCG -3'
(R):5'- AAGGGCTGTCGTCTTCATTG -3'

Sequencing Primer
(F):5'- AGATACTCCGTTATTCATTGAGGAGG -3'
(R):5'- AGGGCTGTCGTCTTCATTGTCATC -3'
Posted On2018-04-27