Mutagenetix > Incidental Mutations

Incidental Mutation 'R6360:Nectin3'

513093

Institutional Source

Beutler Lab

Gene Symbol

Nectin3

Ensembl Gene

ENSMUSG00000022656

Gene Name

nectin cell adhesion molecule 3

Synonyms

3000002N23Rik, 2610301B19Rik, nectin-3, 4921513D19Rik, Pvrl3

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.253) question?

Stock #

R6360 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

46387706-46498525 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 46411109 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 21 (T21S)

Ref Sequence

ENSEMBL: ENSMUSP00000112567 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023335] [ENSMUST00000119941] [ENSMUST00000121245] [ENSMUST00000121803]

Predicted Effect

probably benign
Transcript: ENSMUST00000023335

SMART Domains

Protein: ENSMUSP00000023335
Gene: ENSMUSG00000022656

Domain	Start	End	E-Value	Type
low complexity region	24	48	N/A	INTRINSIC
IG	63	167	5.04e-9	SMART
Pfam:C2-set_2	173	257	2.5e-19	PFAM
Pfam:Ig_2	281	355	1.3e-6	PFAM
transmembrane domain	368	390	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000119941
AA Change: T21S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

Predicted Effect

probably benign
Transcript: ENSMUST00000121245

SMART Domains

Protein: ENSMUSP00000113146
Gene: ENSMUSG00000022656

Domain	Start	End	E-Value	Type
transmembrane domain	43	65	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000121803
AA Change: T21S

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)

Predicted Effect

probably benign
Transcript: ENSMUST00000124602

SMART Domains

Protein: ENSMUSP00000115927
Gene: ENSMUSG00000022656

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.2%

Validation Efficiency

98% (59/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nectin family of proteins, which function as adhesion molecules at adherens junctions. This family member interacts with other nectin-like proteins and with afadin, a filamentous actin-binding protein involved in the regulation of directional motility, cell proliferation and survival. This gene plays a role in ocular development involving the ciliary body. Mutations in this gene are believed to result in congenital ocular defects. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice exhibit male infertility and eye abnormalities including microphthalmia, absent vitreous body, abnormal ciliary body, retinal layers, and lenses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgap10	G	A	8: 77,259,202	Q657*	probably null	Het
Car15	T	C	16: 17,838,066	T560A	probably benign	Het
Cass4	C	T	2: 172,432,611	H769Y	probably damaging	Het
Cdh6	A	G	15: 13,041,460	I506T	possibly damaging	Het
Clstn3	G	T	6: 124,438,429	R659S	possibly damaging	Het
Cntnap5b	C	T	1: 100,431,736	R695*	probably null	Het
Cpsf1	CCCCTGCATGAGGCAGGTCCC	CCCC	15: 76,597,455		probably null	Het
Dab2ip	A	G	2: 35,710,266	H355R	probably benign	Het
Dennd2a	C	T	6: 39,493,142	A539T	probably benign	Het
Dnajc18	T	C	18: 35,686,709	E173G	probably damaging	Het
Dock7	T	C	4: 98,969,662	I1472V	probably benign	Het
Esco1	A	T	18: 10,574,931	F714I	probably damaging	Het
Fam107a	T	G	14: 8,299,619	H73P	probably damaging	Het
Fam46b	T	C	4: 133,486,756	F313L	probably damaging	Het
Flg	A	G	3: 93,290,601		probably benign	Het
Fyn	C	A	10: 39,526,883	T217K	possibly damaging	Het
Gbp9	T	C	5: 105,083,730	D330G	probably benign	Het
Gin1	T	C	1: 97,792,539	S509P	possibly damaging	Het
Gm15922	A	T	7: 3,736,504	L455Q	probably damaging	Het
Gm17067	A	C	7: 42,708,482	S199A	probably benign	Het
Grk4	A	T	5: 34,674,537	K50M	probably damaging	Het
Inpp4b	A	G	8: 81,902,852	H272R	probably benign	Het
Ipo7	T	A	7: 110,027,129	L48Q	probably damaging	Het
Kbtbd2	A	G	6: 56,779,206	I515T	probably damaging	Het
Kcnu1	T	A	8: 25,861,180	S190R	possibly damaging	Het
Kpnb1	T	C	11: 97,173,270	N336S	probably benign	Het
Lbr	G	T	1: 181,832,155	D158E	probably benign	Het
Mphosph10	T	C	7: 64,389,955	Q89R	probably benign	Het
Numb	C	A	12: 83,797,262	R383L	probably damaging	Het
Olfr1370	A	T	13: 21,072,583	N239K	probably damaging	Het
Olfr461	G	T	6: 40,544,713	Q89K	possibly damaging	Het
Park2	T	C	17: 12,004,052	F363S	probably damaging	Het
Pcdhb11	A	T	18: 37,422,159	I181F	probably benign	Het
Pcgf2	T	A	11: 97,692,409		probably null	Het
Pdzd8	T	C	19: 59,300,983	T662A	probably benign	Het
Pex13	A	C	11: 23,655,690	V180G	probably benign	Het
Pkp4	T	A	2: 59,214,747	V22D	probably benign	Het
Ppp1r32	T	C	19: 10,479,481	N167D	probably damaging	Het
Prpf4b	A	C	13: 34,901,433	D954A	probably damaging	Het
Rfx8	T	C	1: 39,680,965	I317V	probably benign	Het
Rnaseh2b	T	C	14: 62,361,419	S198P	probably damaging	Het
Rock1	A	T	18: 10,116,778	C453S	possibly damaging	Het
Scarf1	G	T	11: 75,515,669	G260W	probably damaging	Het
Scyl1	T	C	19: 5,760,571	E538G	probably damaging	Het
Sec14l5	A	T	16: 5,172,995	I267F	probably damaging	Het
Senp6	T	A	9: 80,113,806	V256D	probably benign	Het
Sf3b4	G	A	3: 96,176,728		probably benign	Het
Ssh1	T	C	5: 113,961,347		probably null	Het
Tas2r143	A	C	6: 42,400,835	M200L	probably benign	Het
Tbc1d22a	C	T	15: 86,214,629	P19S	probably damaging	Het
Tmc5	T	A	7: 118,633,966	M1K	probably null	Het
Tnc	T	C	4: 64,000,733	Y1151C	probably damaging	Het
Tshz3	A	G	7: 36,769,441	E285G	probably damaging	Het
Txndc11	C	T	16: 11,084,792	V664M	probably damaging	Het
Ube2g1	A	T	11: 72,663,082	N20Y	probably damaging	Het
Ufl1	T	A	4: 25,265,476	I369L	probably benign	Het
Vwf	A	T	6: 125,683,526	T2666S	probably benign	Het
Yif1a	A	G	19: 5,092,341	M259V	probably benign	Het
Zbtb46	T	C	2: 181,391,455	D471G	probably damaging	Het

Other mutations in Nectin3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01456:Nectin3	APN	16	46458853	missense	probably benign	0.23
R0373:Nectin3	UTSW	16	46458187	missense	probably damaging	0.99
R0550:Nectin3	UTSW	16	46458820	missense	possibly damaging	0.86
R1219:Nectin3	UTSW	16	46454679	nonsense	probably null
R1251:Nectin3	UTSW	16	46463842	missense	possibly damaging	0.82
R1398:Nectin3	UTSW	16	46448756	missense	possibly damaging	0.95
R1439:Nectin3	UTSW	16	46448394	nonsense	probably null
R2250:Nectin3	UTSW	16	46454736	missense	probably benign	0.00
R2448:Nectin3	UTSW	16	46448515	splice site	probably null
R2483:Nectin3	UTSW	16	46395179	missense	possibly damaging	0.83
R4523:Nectin3	UTSW	16	46448590	missense	probably benign	0.15
R4709:Nectin3	UTSW	16	46463943	missense	possibly damaging	0.58
R4809:Nectin3	UTSW	16	46448160	intron	probably benign
R4884:Nectin3	UTSW	16	46448886	missense	probably benign	0.01
R5051:Nectin3	UTSW	16	46448550	missense	possibly damaging	0.95
R5061:Nectin3	UTSW	16	46448449	missense	probably benign	0.03
R5272:Nectin3	UTSW	16	46448476	missense	possibly damaging	0.82
R5365:Nectin3	UTSW	16	46464106	nonsense	probably null
R5768:Nectin3	UTSW	16	46458817	missense	probably damaging	0.98
R5987:Nectin3	UTSW	16	46464145	missense	probably benign	0.00
R6029:Nectin3	UTSW	16	46436400	missense	probably benign	0.08
R6131:Nectin3	UTSW	16	46395152	missense	probably damaging	0.98
R6251:Nectin3	UTSW	16	46395150	missense	probably damaging	0.99
R6299:Nectin3	UTSW	16	46463982	missense	probably damaging	0.98
R6347:Nectin3	UTSW	16	46458124	missense	probably benign	0.01
R6505:Nectin3	UTSW	16	46448821	missense	possibly damaging	0.68
R6703:Nectin3	UTSW	16	46463842	missense	probably damaging	0.99
R6869:Nectin3	UTSW	16	46395143	missense	probably damaging	0.96
R7184:Nectin3	UTSW	16	46395121	missense	possibly damaging	0.66
R7298:Nectin3	UTSW	16	46448396	missense	probably damaging	1.00
R7455:Nectin3	UTSW	16	46496742	nonsense	probably null
R7973:Nectin3	UTSW	16	46396121	missense	probably benign	0.13
R7993:Nectin3	UTSW	16	46458821	missense	probably benign	0.01
R8108:Nectin3	UTSW	16	46464121	missense	possibly damaging	0.84
R8259:Nectin3	UTSW	16	46436391	missense	probably benign	0.00
R8511:Nectin3	UTSW	16	46464000	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAGACCTCCTTGGATACCATTAGG -3'
(R):5'- AGTCTCAGATGTTACGGGCC -3'

Sequencing Primer
(F):5'- TTGGATACCATTAGGAACCCCG -3'
(R):5'- TCCGAGTATTGTGATAAAGGGG -3'

Posted On

2018-04-27