Incidental Mutation 'R6360:Park2'
ID513094
Institutional Source Beutler Lab
Gene Symbol Park2
Ensembl Gene ENSMUSG00000023826
Gene NameParkinson disease (autosomal recessive, juvenile) 2, parkin
SynonymsPRKN
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.218) question?
Stock #R6360 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location10840384-12063361 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12004052 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 363 (F363S)
Ref Sequence ENSEMBL: ENSMUSP00000140587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000191124]
PDB Structure NMR structure of ubiquitin-like domain in murine Parkin [SOLUTION NMR]
Crystal structure of ubiquitin-like domain of murine Parkin [X-RAY DIFFRACTION]
Crystal Structure of parkin ubiquitin-like domain R33Q mutant [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000191124
AA Change: F363S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140587
Gene: ENSMUSG00000023826
AA Change: F363S

DomainStartEndE-ValueType
UBQ 1 72 3.58e-15 SMART
Blast:UBQ 203 230 2e-6 BLAST
Blast:RING 237 295 7e-11 BLAST
IBR 312 376 1.2e-14 SMART
IBR 400 456 5.16e-2 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The precise function of this gene is unknown; however, the encoded protein is a component of a multiprotein E3 ubiquitin ligase complex that mediates the targeting of substrate proteins for proteasomal degradation. Mutations in this gene are known to cause Parkinson disease and autosomal recessive juvenile Parkinson disease. Alternative splicing of this gene produces multiple transcript variants encoding distinct isoforms. Additional splice variants of this gene have been described but currently lack transcript support. [provided by RefSeq, Jul 2008]
PHENOTYPE: Dopamine and glutatamate transmission are impaired in some targeted null mice, resulting in decreased exploratory behavior. These mice show decreased body weight and temperature. Park2 is inactivated as part of a large deletion in the quaking mouse, a dysmyelinating mutant with a pronounced tremor. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap10 G A 8: 77,259,202 Q657* probably null Het
Car15 T C 16: 17,838,066 T560A probably benign Het
Cass4 C T 2: 172,432,611 H769Y probably damaging Het
Cdh6 A G 15: 13,041,460 I506T possibly damaging Het
Clstn3 G T 6: 124,438,429 R659S possibly damaging Het
Cntnap5b C T 1: 100,431,736 R695* probably null Het
Cpsf1 CCCCTGCATGAGGCAGGTCCC CCCC 15: 76,597,455 probably null Het
Dab2ip A G 2: 35,710,266 H355R probably benign Het
Dennd2a C T 6: 39,493,142 A539T probably benign Het
Dnajc18 T C 18: 35,686,709 E173G probably damaging Het
Dock7 T C 4: 98,969,662 I1472V probably benign Het
Esco1 A T 18: 10,574,931 F714I probably damaging Het
Fam107a T G 14: 8,299,619 H73P probably damaging Het
Fam46b T C 4: 133,486,756 F313L probably damaging Het
Flg A G 3: 93,290,601 probably benign Het
Fyn C A 10: 39,526,883 T217K possibly damaging Het
Gbp9 T C 5: 105,083,730 D330G probably benign Het
Gin1 T C 1: 97,792,539 S509P possibly damaging Het
Gm15922 A T 7: 3,736,504 L455Q probably damaging Het
Gm17067 A C 7: 42,708,482 S199A probably benign Het
Grk4 A T 5: 34,674,537 K50M probably damaging Het
Inpp4b A G 8: 81,902,852 H272R probably benign Het
Ipo7 T A 7: 110,027,129 L48Q probably damaging Het
Kbtbd2 A G 6: 56,779,206 I515T probably damaging Het
Kcnu1 T A 8: 25,861,180 S190R possibly damaging Het
Kpnb1 T C 11: 97,173,270 N336S probably benign Het
Lbr G T 1: 181,832,155 D158E probably benign Het
Mphosph10 T C 7: 64,389,955 Q89R probably benign Het
Nectin3 T A 16: 46,411,109 T21S probably benign Het
Numb C A 12: 83,797,262 R383L probably damaging Het
Olfr1370 A T 13: 21,072,583 N239K probably damaging Het
Olfr461 G T 6: 40,544,713 Q89K possibly damaging Het
Pcdhb11 A T 18: 37,422,159 I181F probably benign Het
Pcgf2 T A 11: 97,692,409 probably null Het
Pdzd8 T C 19: 59,300,983 T662A probably benign Het
Pex13 A C 11: 23,655,690 V180G probably benign Het
Pkp4 T A 2: 59,214,747 V22D probably benign Het
Ppp1r32 T C 19: 10,479,481 N167D probably damaging Het
Prpf4b A C 13: 34,901,433 D954A probably damaging Het
Rfx8 T C 1: 39,680,965 I317V probably benign Het
Rnaseh2b T C 14: 62,361,419 S198P probably damaging Het
Rock1 A T 18: 10,116,778 C453S possibly damaging Het
Scarf1 G T 11: 75,515,669 G260W probably damaging Het
Scyl1 T C 19: 5,760,571 E538G probably damaging Het
Sec14l5 A T 16: 5,172,995 I267F probably damaging Het
Senp6 T A 9: 80,113,806 V256D probably benign Het
Sf3b4 G A 3: 96,176,728 probably benign Het
Ssh1 T C 5: 113,961,347 probably null Het
Tas2r143 A C 6: 42,400,835 M200L probably benign Het
Tbc1d22a C T 15: 86,214,629 P19S probably damaging Het
Tmc5 T A 7: 118,633,966 M1K probably null Het
Tnc T C 4: 64,000,733 Y1151C probably damaging Het
Tshz3 A G 7: 36,769,441 E285G probably damaging Het
Txndc11 C T 16: 11,084,792 V664M probably damaging Het
Ube2g1 A T 11: 72,663,082 N20Y probably damaging Het
Ufl1 T A 4: 25,265,476 I369L probably benign Het
Vwf A T 6: 125,683,526 T2666S probably benign Het
Yif1a A G 19: 5,092,341 M259V probably benign Het
Zbtb46 T C 2: 181,391,455 D471G probably damaging Het
Other mutations in Park2
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4304:Park2 UTSW 17 11854763 missense probably damaging 1.00
FR4340:Park2 UTSW 17 11854763 missense probably damaging 1.00
FR4342:Park2 UTSW 17 11854763 missense probably damaging 1.00
PIT4651001:Park2 UTSW 17 11067243 missense probably damaging 1.00
R0333:Park2 UTSW 17 11067140 missense probably damaging 1.00
R0543:Park2 UTSW 17 11067179 missense probably damaging 1.00
R4460:Park2 UTSW 17 12061646 missense probably damaging 1.00
R4710:Park2 UTSW 17 11854833 missense possibly damaging 0.89
R4742:Park2 UTSW 17 11237704 critical splice donor site probably null
R4752:Park2 UTSW 17 12004123 missense probably benign
R4911:Park2 UTSW 17 10840472 utr 5 prime probably benign
R5653:Park2 UTSW 17 11237649 missense probably damaging 1.00
R5654:Park2 UTSW 17 11237649 missense probably damaging 1.00
R5655:Park2 UTSW 17 11237649 missense probably damaging 1.00
R6698:Park2 UTSW 17 11067296 splice site probably null
R7163:Park2 UTSW 17 12061547 missense probably damaging 1.00
R7241:Park2 UTSW 17 11854861 missense possibly damaging 0.63
R7475:Park2 UTSW 17 11434614 missense probably benign
R7630:Park2 UTSW 17 11237568 missense probably benign
R8278:Park2 UTSW 17 12050722 missense probably benign 0.26
R8299:Park2 UTSW 17 11237521 missense probably benign 0.25
R8551:Park2 UTSW 17 11067216 missense probably damaging 0.99
R8558:Park2 UTSW 17 11237585 missense probably benign
R8706:Park2 UTSW 17 11237585 missense probably benign
R8867:Park2 UTSW 17 11237561 missense probably benign 0.00
X0010:Park2 UTSW 17 11237576 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACGGTTCATCTCTGTAACCCTG -3'
(R):5'- AGGCTCACTCAGTTGCAAGG -3'

Sequencing Primer
(F):5'- TGTAACCCTGTTGAGGCACACAG -3'
(R):5'- ACTCAGTTGCAAGGTTTCTGC -3'
Posted On2018-04-27