Incidental Mutation 'R6360:Esco1'
ID513096
Institutional Source Beutler Lab
Gene Symbol Esco1
Ensembl Gene ENSMUSG00000024293
Gene Nameestablishment of sister chromatid cohesion N-acetyltransferase 1
SynonymsA930014I12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.370) question?
Stock #R6360 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location10566602-10610352 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 10574931 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 714 (F714I)
Ref Sequence ENSEMBL: ENSMUSP00000025142 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025142] [ENSMUST00000097670] [ENSMUST00000115864]
Predicted Effect probably damaging
Transcript: ENSMUST00000025142
AA Change: F714I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025142
Gene: ENSMUSG00000024293
AA Change: F714I

DomainStartEndE-ValueType
coiled coil region 8 32 N/A INTRINSIC
low complexity region 117 128 N/A INTRINSIC
low complexity region 322 338 N/A INTRINSIC
low complexity region 463 477 N/A INTRINSIC
Pfam:zf-C2H2_3 607 646 4.7e-17 PFAM
Pfam:Acetyltransf_13 766 834 1.3e-32 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000097670
AA Change: F215I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095274
Gene: ENSMUSG00000024293
AA Change: F215I

DomainStartEndE-ValueType
Pfam:zf-C2H2_3 108 148 1.7e-19 PFAM
Pfam:Acetyltransf_13 266 335 4.6e-35 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115864
AA Change: F190I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000111530
Gene: ENSMUSG00000024293
AA Change: F190I

DomainStartEndE-ValueType
Pfam:zf-C2H2_3 83 123 1.8e-19 PFAM
Pfam:Acetyltransf_13 241 310 4.1e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127099
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145320
Meta Mutation Damage Score 0.2461 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ESCO1 belongs to a conserved family of acetyltransferases involved in sister chromatid cohesion (Hou and Zou, 2005 [PubMed 15958495]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap10 G A 8: 77,259,202 Q657* probably null Het
Car15 T C 16: 17,838,066 T560A probably benign Het
Cass4 C T 2: 172,432,611 H769Y probably damaging Het
Cdh6 A G 15: 13,041,460 I506T possibly damaging Het
Clstn3 G T 6: 124,438,429 R659S possibly damaging Het
Cntnap5b C T 1: 100,431,736 R695* probably null Het
Cpsf1 CCCCTGCATGAGGCAGGTCCC CCCC 15: 76,597,455 probably null Het
Dab2ip A G 2: 35,710,266 H355R probably benign Het
Dennd2a C T 6: 39,493,142 A539T probably benign Het
Dnajc18 T C 18: 35,686,709 E173G probably damaging Het
Dock7 T C 4: 98,969,662 I1472V probably benign Het
Fam107a T G 14: 8,299,619 H73P probably damaging Het
Fam46b T C 4: 133,486,756 F313L probably damaging Het
Flg A G 3: 93,290,601 probably benign Het
Fyn C A 10: 39,526,883 T217K possibly damaging Het
Gbp9 T C 5: 105,083,730 D330G probably benign Het
Gin1 T C 1: 97,792,539 S509P possibly damaging Het
Gm15922 A T 7: 3,736,504 L455Q probably damaging Het
Gm17067 A C 7: 42,708,482 S199A probably benign Het
Grk4 A T 5: 34,674,537 K50M probably damaging Het
Inpp4b A G 8: 81,902,852 H272R probably benign Het
Ipo7 T A 7: 110,027,129 L48Q probably damaging Het
Kbtbd2 A G 6: 56,779,206 I515T probably damaging Het
Kcnu1 T A 8: 25,861,180 S190R possibly damaging Het
Kpnb1 T C 11: 97,173,270 N336S probably benign Het
Lbr G T 1: 181,832,155 D158E probably benign Het
Mphosph10 T C 7: 64,389,955 Q89R probably benign Het
Nectin3 T A 16: 46,411,109 T21S probably benign Het
Numb C A 12: 83,797,262 R383L probably damaging Het
Olfr1370 A T 13: 21,072,583 N239K probably damaging Het
Olfr461 G T 6: 40,544,713 Q89K possibly damaging Het
Park2 T C 17: 12,004,052 F363S probably damaging Het
Pcdhb11 A T 18: 37,422,159 I181F probably benign Het
Pcgf2 T A 11: 97,692,409 probably null Het
Pdzd8 T C 19: 59,300,983 T662A probably benign Het
Pex13 A C 11: 23,655,690 V180G probably benign Het
Pkp4 T A 2: 59,214,747 V22D probably benign Het
Ppp1r32 T C 19: 10,479,481 N167D probably damaging Het
Prpf4b A C 13: 34,901,433 D954A probably damaging Het
Rfx8 T C 1: 39,680,965 I317V probably benign Het
Rnaseh2b T C 14: 62,361,419 S198P probably damaging Het
Rock1 A T 18: 10,116,778 C453S possibly damaging Het
Scarf1 G T 11: 75,515,669 G260W probably damaging Het
Scyl1 T C 19: 5,760,571 E538G probably damaging Het
Sec14l5 A T 16: 5,172,995 I267F probably damaging Het
Senp6 T A 9: 80,113,806 V256D probably benign Het
Sf3b4 G A 3: 96,176,728 probably benign Het
Ssh1 T C 5: 113,961,347 probably null Het
Tas2r143 A C 6: 42,400,835 M200L probably benign Het
Tbc1d22a C T 15: 86,214,629 P19S probably damaging Het
Tmc5 T A 7: 118,633,966 M1K probably null Het
Tnc T C 4: 64,000,733 Y1151C probably damaging Het
Tshz3 A G 7: 36,769,441 E285G probably damaging Het
Txndc11 C T 16: 11,084,792 V664M probably damaging Het
Ube2g1 A T 11: 72,663,082 N20Y probably damaging Het
Ufl1 T A 4: 25,265,476 I369L probably benign Het
Vwf A T 6: 125,683,526 T2666S probably benign Het
Yif1a A G 19: 5,092,341 M259V probably benign Het
Zbtb46 T C 2: 181,391,455 D471G probably damaging Het
Other mutations in Esco1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Esco1 APN 18 10582078 missense probably damaging 1.00
IGL01376:Esco1 APN 18 10594892 nonsense probably null
IGL01886:Esco1 APN 18 10595262 missense probably damaging 1.00
IGL03171:Esco1 APN 18 10594263 missense probably damaging 1.00
IGL03233:Esco1 APN 18 10574877 missense probably damaging 1.00
PIT4576001:Esco1 UTSW 18 10572093 missense probably damaging 1.00
PIT4585001:Esco1 UTSW 18 10594355 nonsense probably null
R0266:Esco1 UTSW 18 10594605 missense probably benign 0.00
R0445:Esco1 UTSW 18 10574989 missense probably damaging 1.00
R0494:Esco1 UTSW 18 10594940 missense probably benign 0.28
R0965:Esco1 UTSW 18 10567570 missense probably damaging 1.00
R1834:Esco1 UTSW 18 10594350 missense probably damaging 1.00
R2140:Esco1 UTSW 18 10574873 critical splice donor site probably null
R2141:Esco1 UTSW 18 10574873 critical splice donor site probably null
R2142:Esco1 UTSW 18 10574873 critical splice donor site probably null
R4562:Esco1 UTSW 18 10595074 missense possibly damaging 0.74
R4668:Esco1 UTSW 18 10594734 missense possibly damaging 0.60
R5083:Esco1 UTSW 18 10594734 missense probably benign 0.00
R5128:Esco1 UTSW 18 10567468 utr 3 prime probably benign
R5407:Esco1 UTSW 18 10574886 missense probably damaging 1.00
R5454:Esco1 UTSW 18 10584327 missense probably benign
R5870:Esco1 UTSW 18 10593744 critical splice donor site probably null
R5965:Esco1 UTSW 18 10593867 missense possibly damaging 0.94
R6390:Esco1 UTSW 18 10567528 missense probably damaging 1.00
R6438:Esco1 UTSW 18 10572031 missense probably damaging 1.00
R6524:Esco1 UTSW 18 10582188 critical splice acceptor site probably null
R6534:Esco1 UTSW 18 10594794 missense possibly damaging 0.90
R6633:Esco1 UTSW 18 10595738 intron probably benign
Predicted Primers PCR Primer
(F):5'- ACGGACTAATTCCCACCTTCAT -3'
(R):5'- TCAGCACATATACCTAAAATAGTCCT -3'

Sequencing Primer
(F):5'- ATGGTGGCTCACAACCATCTG -3'
(R):5'- AATAGTCCTTCAAGCTGGGC -3'
Posted On2018-04-27