Incidental Mutation 'R6360:Dnajc18'
ID513097
Institutional Source Beutler Lab
Gene Symbol Dnajc18
Ensembl Gene ENSMUSG00000024350
Gene NameDnaJ heat shock protein family (Hsp40) member C18
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R6360 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location35671103-35703144 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35686709 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 173 (E173G)
Ref Sequence ENSEMBL: ENSMUSP00000025208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025208]
Predicted Effect probably damaging
Transcript: ENSMUST00000025208
AA Change: E173G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025208
Gene: ENSMUSG00000024350
AA Change: E173G

DomainStartEndE-ValueType
DnaJ 81 138 6.52e-27 SMART
low complexity region 200 218 N/A INTRINSIC
Pfam:DUF1977 243 349 1.7e-28 PFAM
Meta Mutation Damage Score 0.3662 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap10 G A 8: 77,259,202 Q657* probably null Het
Car15 T C 16: 17,838,066 T560A probably benign Het
Cass4 C T 2: 172,432,611 H769Y probably damaging Het
Cdh6 A G 15: 13,041,460 I506T possibly damaging Het
Clstn3 G T 6: 124,438,429 R659S possibly damaging Het
Cntnap5b C T 1: 100,431,736 R695* probably null Het
Cpsf1 CCCCTGCATGAGGCAGGTCCC CCCC 15: 76,597,455 probably null Het
Dab2ip A G 2: 35,710,266 H355R probably benign Het
Dennd2a C T 6: 39,493,142 A539T probably benign Het
Dock7 T C 4: 98,969,662 I1472V probably benign Het
Esco1 A T 18: 10,574,931 F714I probably damaging Het
Fam107a T G 14: 8,299,619 H73P probably damaging Het
Fam46b T C 4: 133,486,756 F313L probably damaging Het
Flg A G 3: 93,290,601 probably benign Het
Fyn C A 10: 39,526,883 T217K possibly damaging Het
Gbp9 T C 5: 105,083,730 D330G probably benign Het
Gin1 T C 1: 97,792,539 S509P possibly damaging Het
Gm15922 A T 7: 3,736,504 L455Q probably damaging Het
Gm17067 A C 7: 42,708,482 S199A probably benign Het
Grk4 A T 5: 34,674,537 K50M probably damaging Het
Inpp4b A G 8: 81,902,852 H272R probably benign Het
Ipo7 T A 7: 110,027,129 L48Q probably damaging Het
Kbtbd2 A G 6: 56,779,206 I515T probably damaging Het
Kcnu1 T A 8: 25,861,180 S190R possibly damaging Het
Kpnb1 T C 11: 97,173,270 N336S probably benign Het
Lbr G T 1: 181,832,155 D158E probably benign Het
Mphosph10 T C 7: 64,389,955 Q89R probably benign Het
Nectin3 T A 16: 46,411,109 T21S probably benign Het
Numb C A 12: 83,797,262 R383L probably damaging Het
Olfr1370 A T 13: 21,072,583 N239K probably damaging Het
Olfr461 G T 6: 40,544,713 Q89K possibly damaging Het
Park2 T C 17: 12,004,052 F363S probably damaging Het
Pcdhb11 A T 18: 37,422,159 I181F probably benign Het
Pcgf2 T A 11: 97,692,409 probably null Het
Pdzd8 T C 19: 59,300,983 T662A probably benign Het
Pex13 A C 11: 23,655,690 V180G probably benign Het
Pkp4 T A 2: 59,214,747 V22D probably benign Het
Ppp1r32 T C 19: 10,479,481 N167D probably damaging Het
Prpf4b A C 13: 34,901,433 D954A probably damaging Het
Rfx8 T C 1: 39,680,965 I317V probably benign Het
Rnaseh2b T C 14: 62,361,419 S198P probably damaging Het
Rock1 A T 18: 10,116,778 C453S possibly damaging Het
Scarf1 G T 11: 75,515,669 G260W probably damaging Het
Scyl1 T C 19: 5,760,571 E538G probably damaging Het
Sec14l5 A T 16: 5,172,995 I267F probably damaging Het
Senp6 T A 9: 80,113,806 V256D probably benign Het
Sf3b4 G A 3: 96,176,728 probably benign Het
Ssh1 T C 5: 113,961,347 probably null Het
Tas2r143 A C 6: 42,400,835 M200L probably benign Het
Tbc1d22a C T 15: 86,214,629 P19S probably damaging Het
Tmc5 T A 7: 118,633,966 M1K probably null Het
Tnc T C 4: 64,000,733 Y1151C probably damaging Het
Tshz3 A G 7: 36,769,441 E285G probably damaging Het
Txndc11 C T 16: 11,084,792 V664M probably damaging Het
Ube2g1 A T 11: 72,663,082 N20Y probably damaging Het
Ufl1 T A 4: 25,265,476 I369L probably benign Het
Vwf A T 6: 125,683,526 T2666S probably benign Het
Yif1a A G 19: 5,092,341 M259V probably benign Het
Zbtb46 T C 2: 181,391,455 D471G probably damaging Het
Other mutations in Dnajc18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01061:Dnajc18 APN 18 35680942 splice site probably benign
IGL01152:Dnajc18 APN 18 35680873 missense probably benign 0.02
IGL01621:Dnajc18 APN 18 35680840 missense probably benign
IGL03201:Dnajc18 APN 18 35680919 missense probably benign 0.19
R1464:Dnajc18 UTSW 18 35680847 missense possibly damaging 0.88
R1464:Dnajc18 UTSW 18 35680847 missense possibly damaging 0.88
R1801:Dnajc18 UTSW 18 35680804 missense probably damaging 1.00
R3893:Dnajc18 UTSW 18 35700995 splice site probably null
R4974:Dnajc18 UTSW 18 35683319 missense possibly damaging 0.75
R5234:Dnajc18 UTSW 18 35683298 missense probably benign 0.12
R6326:Dnajc18 UTSW 18 35680925 missense possibly damaging 0.95
R6460:Dnajc18 UTSW 18 35700910 missense probably benign 0.41
R7215:Dnajc18 UTSW 18 35681981 missense probably benign
R7492:Dnajc18 UTSW 18 35686793 missense probably damaging 1.00
R8290:Dnajc18 UTSW 18 35683271 nonsense probably null
X0063:Dnajc18 UTSW 18 35686733 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CTGCTGAGAGCCATAAATAAATGGG -3'
(R):5'- GCAATAGCCAAGGATGTGCTG -3'

Sequencing Primer
(F):5'- CTGGAACTCACTTTGTAGACCAGG -3'
(R):5'- CAATAGCCAAGGATGTGCTGATGTTG -3'
Posted On2018-04-27