Incidental Mutation 'R6360:Pcdhb11'
ID513098
Institutional Source Beutler Lab
Gene Symbol Pcdhb11
Ensembl Gene ENSMUSG00000051486
Gene Nameprotocadherin beta 11
SynonymsPcdhb5E, PcdhbK
MMRRC Submission
Accession Numbers

Genbank: NM_053136.3; Ensembl: ENSMUST00000053073

Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R6360 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location37421418-37425836 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37422159 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 181 (I181F)
Ref Sequence ENSEMBL: ENSMUSP00000056148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053073] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably benign
Transcript: ENSMUST00000053073
AA Change: I181F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000056148
Gene: ENSMUSG00000051486
AA Change: I181F

DomainStartEndE-ValueType
CA 54 131 3.51e-1 SMART
CA 155 240 4.11e-21 SMART
CA 264 344 6.37e-27 SMART
CA 367 448 4.79e-22 SMART
CA 472 558 7.31e-27 SMART
CA 588 669 2.46e-10 SMART
Pfam:Cadherin_C_2 686 769 3.4e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap10 G A 8: 77,259,202 Q657* probably null Het
Car15 T C 16: 17,838,066 T560A probably benign Het
Cass4 C T 2: 172,432,611 H769Y probably damaging Het
Cdh6 A G 15: 13,041,460 I506T possibly damaging Het
Clstn3 G T 6: 124,438,429 R659S possibly damaging Het
Cntnap5b C T 1: 100,431,736 R695* probably null Het
Cpsf1 CCCCTGCATGAGGCAGGTCCC CCCC 15: 76,597,455 probably null Het
Dab2ip A G 2: 35,710,266 H355R probably benign Het
Dennd2a C T 6: 39,493,142 A539T probably benign Het
Dnajc18 T C 18: 35,686,709 E173G probably damaging Het
Dock7 T C 4: 98,969,662 I1472V probably benign Het
Esco1 A T 18: 10,574,931 F714I probably damaging Het
Fam107a T G 14: 8,299,619 H73P probably damaging Het
Fam46b T C 4: 133,486,756 F313L probably damaging Het
Flg A G 3: 93,290,601 probably benign Het
Fyn C A 10: 39,526,883 T217K possibly damaging Het
Gbp9 T C 5: 105,083,730 D330G probably benign Het
Gin1 T C 1: 97,792,539 S509P possibly damaging Het
Gm15922 A T 7: 3,736,504 L455Q probably damaging Het
Gm17067 A C 7: 42,708,482 S199A probably benign Het
Grk4 A T 5: 34,674,537 K50M probably damaging Het
Inpp4b A G 8: 81,902,852 H272R probably benign Het
Ipo7 T A 7: 110,027,129 L48Q probably damaging Het
Kbtbd2 A G 6: 56,779,206 I515T probably damaging Het
Kcnu1 T A 8: 25,861,180 S190R possibly damaging Het
Kpnb1 T C 11: 97,173,270 N336S probably benign Het
Lbr G T 1: 181,832,155 D158E probably benign Het
Mphosph10 T C 7: 64,389,955 Q89R probably benign Het
Nectin3 T A 16: 46,411,109 T21S probably benign Het
Numb C A 12: 83,797,262 R383L probably damaging Het
Olfr1370 A T 13: 21,072,583 N239K probably damaging Het
Olfr461 G T 6: 40,544,713 Q89K possibly damaging Het
Park2 T C 17: 12,004,052 F363S probably damaging Het
Pcgf2 T A 11: 97,692,409 probably null Het
Pdzd8 T C 19: 59,300,983 T662A probably benign Het
Pex13 A C 11: 23,655,690 V180G probably benign Het
Pkp4 T A 2: 59,214,747 V22D probably benign Het
Ppp1r32 T C 19: 10,479,481 N167D probably damaging Het
Prpf4b A C 13: 34,901,433 D954A probably damaging Het
Rfx8 T C 1: 39,680,965 I317V probably benign Het
Rnaseh2b T C 14: 62,361,419 S198P probably damaging Het
Rock1 A T 18: 10,116,778 C453S possibly damaging Het
Scarf1 G T 11: 75,515,669 G260W probably damaging Het
Scyl1 T C 19: 5,760,571 E538G probably damaging Het
Sec14l5 A T 16: 5,172,995 I267F probably damaging Het
Senp6 T A 9: 80,113,806 V256D probably benign Het
Sf3b4 G A 3: 96,176,728 probably benign Het
Ssh1 T C 5: 113,961,347 probably null Het
Tas2r143 A C 6: 42,400,835 M200L probably benign Het
Tbc1d22a C T 15: 86,214,629 P19S probably damaging Het
Tmc5 T A 7: 118,633,966 M1K probably null Het
Tnc T C 4: 64,000,733 Y1151C probably damaging Het
Tshz3 A G 7: 36,769,441 E285G probably damaging Het
Txndc11 C T 16: 11,084,792 V664M probably damaging Het
Ube2g1 A T 11: 72,663,082 N20Y probably damaging Het
Ufl1 T A 4: 25,265,476 I369L probably benign Het
Vwf A T 6: 125,683,526 T2666S probably benign Het
Yif1a A G 19: 5,092,341 M259V probably benign Het
Zbtb46 T C 2: 181,391,455 D471G probably damaging Het
Other mutations in Pcdhb11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Pcdhb11 APN 18 37421973 missense probably benign 0.00
IGL00906:Pcdhb11 APN 18 37422121 missense possibly damaging 0.67
IGL01610:Pcdhb11 APN 18 37423359 missense probably benign 0.00
IGL01973:Pcdhb11 APN 18 37423512 missense probably damaging 1.00
IGL01977:Pcdhb11 APN 18 37422291 missense possibly damaging 0.49
IGL02164:Pcdhb11 APN 18 37423359 missense probably benign 0.00
IGL02282:Pcdhb11 APN 18 37423828 missense probably damaging 1.00
IGL02674:Pcdhb11 APN 18 37423614 missense probably damaging 1.00
IGL02965:Pcdhb11 APN 18 37423968 missense probably benign
IGL03197:Pcdhb11 APN 18 37422424 nonsense probably null
1mM(1):Pcdhb11 UTSW 18 37423957 missense probably benign 0.00
R0001:Pcdhb11 UTSW 18 37423989 missense probably benign 0.06
R0383:Pcdhb11 UTSW 18 37423393 missense probably damaging 1.00
R0421:Pcdhb11 UTSW 18 37422480 missense probably benign 0.04
R0422:Pcdhb11 UTSW 18 37421870 missense probably damaging 1.00
R0427:Pcdhb11 UTSW 18 37422765 missense probably damaging 1.00
R0542:Pcdhb11 UTSW 18 37423834 missense probably damaging 1.00
R0620:Pcdhb11 UTSW 18 37421811 nonsense probably null
R1014:Pcdhb11 UTSW 18 37423369 missense probably damaging 1.00
R1277:Pcdhb11 UTSW 18 37421716 missense possibly damaging 0.79
R2034:Pcdhb11 UTSW 18 37422493 missense probably benign 0.00
R2142:Pcdhb11 UTSW 18 37422123 missense probably benign 0.28
R2496:Pcdhb11 UTSW 18 37422322 missense probably benign 0.30
R3077:Pcdhb11 UTSW 18 37422244 missense probably benign 0.08
R4560:Pcdhb11 UTSW 18 37423734 missense possibly damaging 0.61
R4590:Pcdhb11 UTSW 18 37422496 missense probably damaging 0.98
R4642:Pcdhb11 UTSW 18 37421968 missense probably benign 0.01
R4729:Pcdhb11 UTSW 18 37422366 nonsense probably null
R5012:Pcdhb11 UTSW 18 37422976 missense possibly damaging 0.48
R5364:Pcdhb11 UTSW 18 37422179 missense probably benign 0.06
R5910:Pcdhb11 UTSW 18 37423743 missense probably benign 0.43
R6023:Pcdhb11 UTSW 18 37422925 missense possibly damaging 0.94
R6106:Pcdhb11 UTSW 18 37423003 missense probably damaging 1.00
R6254:Pcdhb11 UTSW 18 37421718 missense probably damaging 0.99
R6276:Pcdhb11 UTSW 18 37421760 missense probably benign 0.36
R6699:Pcdhb11 UTSW 18 37422937 missense probably damaging 1.00
R6732:Pcdhb11 UTSW 18 37422144 missense probably benign
R6760:Pcdhb11 UTSW 18 37421584 intron probably benign
R6916:Pcdhb11 UTSW 18 37422381 missense possibly damaging 0.52
R7130:Pcdhb11 UTSW 18 37423506 missense probably benign 0.04
R7267:Pcdhb11 UTSW 18 37421953 missense possibly damaging 0.61
R7426:Pcdhb11 UTSW 18 37423260 missense probably damaging 0.99
R7444:Pcdhb11 UTSW 18 37422619 missense probably damaging 0.98
R7492:Pcdhb11 UTSW 18 37423444 missense probably damaging 1.00
R7504:Pcdhb11 UTSW 18 37421799 missense probably benign
R7537:Pcdhb11 UTSW 18 37421619 start codon destroyed possibly damaging 0.88
R7728:Pcdhb11 UTSW 18 37423477 missense probably damaging 1.00
R7817:Pcdhb11 UTSW 18 37423909 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCACTTCCAGGTCATACTG -3'
(R):5'- GCGTTATCATTGATGTCCACG -3'

Sequencing Primer
(F):5'- TGGAAAACCCTGTGCAGTTC -3'
(R):5'- GATGTCCACGACTTCAATGTG -3'
Posted On2018-04-27