Incidental Mutation 'R6360:Ppp1r32'
ID513101
Institutional Source Beutler Lab
Gene Symbol Ppp1r32
Ensembl Gene ENSMUSG00000035179
Gene Nameprotein phosphatase 1, regulatory subunit 32
SynonymsIIIG9L, 4930579J09Rik, IIIG9S, IIIG9
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6360 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location10474257-10482897 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 10479481 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 167 (N167D)
Ref Sequence ENSEMBL: ENSMUSP00000035684 (fasta)
Predicted Effect probably damaging
Transcript: ENSMUST00000038842
AA Change: N167D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap10 G A 8: 77,259,202 Q657* probably null Het
Car15 T C 16: 17,838,066 T560A probably benign Het
Cass4 C T 2: 172,432,611 H769Y probably damaging Het
Cdh6 A G 15: 13,041,460 I506T possibly damaging Het
Clstn3 G T 6: 124,438,429 R659S possibly damaging Het
Cntnap5b C T 1: 100,431,736 R695* probably null Het
Cpsf1 CCCCTGCATGAGGCAGGTCCC CCCC 15: 76,597,455 probably null Het
Dab2ip A G 2: 35,710,266 H355R probably benign Het
Dennd2a C T 6: 39,493,142 A539T probably benign Het
Dnajc18 T C 18: 35,686,709 E173G probably damaging Het
Dock7 T C 4: 98,969,662 I1472V probably benign Het
Esco1 A T 18: 10,574,931 F714I probably damaging Het
Fam107a T G 14: 8,299,619 H73P probably damaging Het
Fam46b T C 4: 133,486,756 F313L probably damaging Het
Flg A G 3: 93,290,601 probably benign Het
Fyn C A 10: 39,526,883 T217K possibly damaging Het
Gbp9 T C 5: 105,083,730 D330G probably benign Het
Gin1 T C 1: 97,792,539 S509P possibly damaging Het
Gm15922 A T 7: 3,736,504 L455Q probably damaging Het
Gm17067 A C 7: 42,708,482 S199A probably benign Het
Grk4 A T 5: 34,674,537 K50M probably damaging Het
Inpp4b A G 8: 81,902,852 H272R probably benign Het
Ipo7 T A 7: 110,027,129 L48Q probably damaging Het
Kbtbd2 A G 6: 56,779,206 I515T probably damaging Het
Kcnu1 T A 8: 25,861,180 S190R possibly damaging Het
Kpnb1 T C 11: 97,173,270 N336S probably benign Het
Lbr G T 1: 181,832,155 D158E probably benign Het
Mphosph10 T C 7: 64,389,955 Q89R probably benign Het
Nectin3 T A 16: 46,411,109 T21S probably benign Het
Numb C A 12: 83,797,262 R383L probably damaging Het
Olfr1370 A T 13: 21,072,583 N239K probably damaging Het
Olfr461 G T 6: 40,544,713 Q89K possibly damaging Het
Park2 T C 17: 12,004,052 F363S probably damaging Het
Pcdhb11 A T 18: 37,422,159 I181F probably benign Het
Pcgf2 T A 11: 97,692,409 probably null Het
Pdzd8 T C 19: 59,300,983 T662A probably benign Het
Pex13 A C 11: 23,655,690 V180G probably benign Het
Pkp4 T A 2: 59,214,747 V22D probably benign Het
Prpf4b A C 13: 34,901,433 D954A probably damaging Het
Rfx8 T C 1: 39,680,965 I317V probably benign Het
Rnaseh2b T C 14: 62,361,419 S198P probably damaging Het
Rock1 A T 18: 10,116,778 C453S possibly damaging Het
Scarf1 G T 11: 75,515,669 G260W probably damaging Het
Scyl1 T C 19: 5,760,571 E538G probably damaging Het
Sec14l5 A T 16: 5,172,995 I267F probably damaging Het
Senp6 T A 9: 80,113,806 V256D probably benign Het
Sf3b4 G A 3: 96,176,728 probably benign Het
Ssh1 T C 5: 113,961,347 probably null Het
Tas2r143 A C 6: 42,400,835 M200L probably benign Het
Tbc1d22a C T 15: 86,214,629 P19S probably damaging Het
Tmc5 T A 7: 118,633,966 M1K probably null Het
Tnc T C 4: 64,000,733 Y1151C probably damaging Het
Tshz3 A G 7: 36,769,441 E285G probably damaging Het
Txndc11 C T 16: 11,084,792 V664M probably damaging Het
Ube2g1 A T 11: 72,663,082 N20Y probably damaging Het
Ufl1 T A 4: 25,265,476 I369L probably benign Het
Vwf A T 6: 125,683,526 T2666S probably benign Het
Yif1a A G 19: 5,092,341 M259V probably benign Het
Zbtb46 T C 2: 181,391,455 D471G probably damaging Het
Other mutations in Ppp1r32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Ppp1r32 APN 19 10477523 critical splice donor site probably null
IGL00979:Ppp1r32 APN 19 10474499 makesense probably null
IGL02405:Ppp1r32 APN 19 10474566 missense probably damaging 1.00
IGL02664:Ppp1r32 APN 19 10482291 missense probably damaging 1.00
IGL03105:Ppp1r32 APN 19 10477020 splice site probably benign
R0255:Ppp1r32 UTSW 19 10475054 missense probably damaging 1.00
R0268:Ppp1r32 UTSW 19 10477085 missense possibly damaging 0.88
R1018:Ppp1r32 UTSW 19 10479460 splice site probably benign
R1559:Ppp1r32 UTSW 19 10481406 missense probably benign 0.01
R2384:Ppp1r32 UTSW 19 10481282 critical splice donor site probably null
R4362:Ppp1r32 UTSW 19 10475021 missense probably damaging 1.00
R4884:Ppp1r32 UTSW 19 10474501 makesense probably null
R5998:Ppp1r32 UTSW 19 10481352 missense possibly damaging 0.50
R6130:Ppp1r32 UTSW 19 10477764 missense probably benign 0.16
R6388:Ppp1r32 UTSW 19 10482301 missense probably damaging 1.00
R6625:Ppp1r32 UTSW 19 10481736 missense probably damaging 0.97
R6754:Ppp1r32 UTSW 19 10477089 missense probably damaging 1.00
R7188:Ppp1r32 UTSW 19 10482338 missense probably benign 0.15
R7361:Ppp1r32 UTSW 19 10479579 missense probably damaging 1.00
R7679:Ppp1r32 UTSW 19 10482254 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATGGTGGACACTTTGATGCAG -3'
(R):5'- GCCATGAAGGTGCTCTGTAG -3'

Sequencing Primer
(F):5'- CTCTAGCCGCATATGTAGCGGAAG -3'
(R):5'- CTCTGTAGCAGTGGAGGACAG -3'
Posted On2018-04-27