Incidental Mutation 'R6361:Olfr1230'
ID513107
Institutional Source Beutler Lab
Gene Symbol Olfr1230
Ensembl Gene ENSMUSG00000075094
Gene Nameolfactory receptor 1230
SynonymsGA_x6K02T2Q125-50741934-50741017, MOR237-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R6361 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location89296351-89297268 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89296646 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 208 (I208N)
Ref Sequence ENSEMBL: ENSMUSP00000097375 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099787] [ENSMUST00000216144]
Predicted Effect probably damaging
Transcript: ENSMUST00000099787
AA Change: I208N

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097375
Gene: ENSMUSG00000075094
AA Change: I208N

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 5.7e-44 PFAM
Pfam:7tm_1 39 285 6.8e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216144
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A T 4: 42,972,695 D676V probably benign Het
6430531B16Rik T A 7: 139,976,672 D134V possibly damaging Het
Asap1 C T 15: 64,349,823 probably null Het
Cabin1 G A 10: 75,726,865 A29V possibly damaging Het
Cadps G A 14: 12,491,778 Q791* probably null Het
Cdc14b T C 13: 64,216,209 probably null Het
Cep89 C T 7: 35,398,047 P33S probably damaging Het
Clec18a A G 8: 111,081,029 probably benign Het
Cln5 T A 14: 103,076,201 D296E probably benign Het
Col6a4 A T 9: 106,066,703 S1191T probably benign Het
Crispld1 A G 1: 17,762,231 I480M probably damaging Het
Dhrs7 A C 12: 72,664,659 L32V probably damaging Het
Dscam T C 16: 96,622,811 T1645A probably benign Het
Eif2b3 A G 4: 117,028,425 T55A possibly damaging Het
Ercc6 T C 14: 32,517,110 Y52H probably benign Het
Fam170b C A 14: 32,836,071 Q288K unknown Het
Flt4 A G 11: 49,630,578 T442A probably benign Het
Gm19402 A T 10: 77,690,061 probably benign Het
Gm4841 A G 18: 60,270,760 I87T probably damaging Het
Hspb7 A G 4: 141,422,549 E82G possibly damaging Het
Itgb3 A G 11: 104,665,582 K750E possibly damaging Het
Itsn2 A G 12: 4,629,655 M155V probably benign Het
March8 A T 6: 116,402,101 D332V probably null Het
Mst1r A G 9: 107,915,853 M1042V probably benign Het
Muc4 T C 16: 32,767,351 F2756L probably benign Het
Myl6b T A 10: 128,497,209 K55* probably null Het
Olfr1301 G T 2: 111,754,595 L115F probably damaging Het
Olfr150 A C 9: 39,737,672 N286H probably damaging Het
Olfr348 A G 2: 36,786,780 N85S probably damaging Het
Olfr830 T C 9: 18,875,731 Y132H probably damaging Het
Pcca A G 14: 122,638,382 D141G probably benign Het
Pkd2 C T 5: 104,486,680 R526* probably null Het
Polr2a C A 11: 69,743,337 A756S probably damaging Het
Prkd2 T C 7: 16,847,654 S145P probably damaging Het
Rhbdf1 T C 11: 32,212,915 N451D possibly damaging Het
Rundc3a G A 11: 102,400,795 R358Q probably damaging Het
Tbc1d4 T C 14: 101,507,174 K339E probably damaging Het
Usp37 A G 1: 74,453,893 I723T probably benign Het
Vwa2 A T 19: 56,901,526 probably null Het
Zdbf2 A C 1: 63,303,321 R286S possibly damaging Het
Zfp422 G A 6: 116,626,820 H73Y probably damaging Het
Zfp868 T C 8: 69,611,913 H257R probably damaging Het
Zzef1 A G 11: 72,884,349 S1723G possibly damaging Het
Other mutations in Olfr1230
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Olfr1230 APN 2 89296455 missense probably benign 0.40
IGL01419:Olfr1230 APN 2 89296345 unclassified probably benign
IGL01644:Olfr1230 APN 2 89296632 missense probably benign 0.01
IGL01653:Olfr1230 APN 2 89297127 missense probably benign 0.08
IGL01674:Olfr1230 APN 2 89296670 missense probably damaging 1.00
IGL02124:Olfr1230 APN 2 89297063 missense probably benign 0.01
IGL03053:Olfr1230 APN 2 89296445 missense probably damaging 0.97
R0504:Olfr1230 UTSW 2 89296739 missense probably damaging 0.99
R1473:Olfr1230 UTSW 2 89296906 nonsense probably null
R1742:Olfr1230 UTSW 2 89296424 missense probably damaging 1.00
R1899:Olfr1230 UTSW 2 89296670 missense probably damaging 1.00
R1900:Olfr1230 UTSW 2 89296670 missense probably damaging 1.00
R1945:Olfr1230 UTSW 2 89296784 missense probably damaging 1.00
R2935:Olfr1230 UTSW 2 89297260 missense possibly damaging 0.69
R3421:Olfr1230 UTSW 2 89296553 missense probably benign 0.03
R5185:Olfr1230 UTSW 2 89296387 missense probably benign
R5377:Olfr1230 UTSW 2 89297162 missense probably damaging 0.99
R5400:Olfr1230 UTSW 2 89296913 missense probably damaging 1.00
R6083:Olfr1230 UTSW 2 89297024 missense probably damaging 1.00
R6086:Olfr1230 UTSW 2 89296854 missense probably damaging 1.00
R6155:Olfr1230 UTSW 2 89296421 missense probably damaging 1.00
R6218:Olfr1230 UTSW 2 89296962 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGGATAAGTGACCACAGGCC -3'
(R):5'- GACCATTGTTAGTCCCCGAGTATG -3'

Sequencing Primer
(F):5'- GATAAGTGACCACAGGCCTCATG -3'
(R):5'- TTAGTCCCCGAGTATGCTGGC -3'
Posted On2018-04-27