Incidental Mutation 'R6361:Olfr1301'
ID513108
Institutional Source Beutler Lab
Gene Symbol Olfr1301
Ensembl Gene ENSMUSG00000057149
Gene Nameolfactory receptor 1301
SynonymsGA_x6K02T2Q125-72805651-72806589, MOR248-5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R6361 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location111751006-111758852 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 111754595 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 115 (L115F)
Ref Sequence ENSEMBL: ENSMUSP00000146530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080094] [ENSMUST00000207590]
Predicted Effect probably damaging
Transcript: ENSMUST00000080094
AA Change: L115F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078993
Gene: ENSMUSG00000057149
AA Change: L115F

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 4.1e-53 PFAM
Pfam:7tm_1 41 287 2.2e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000207590
AA Change: L115F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A T 4: 42,972,695 D676V probably benign Het
6430531B16Rik T A 7: 139,976,672 D134V possibly damaging Het
Asap1 C T 15: 64,349,823 probably null Het
Cabin1 G A 10: 75,726,865 A29V possibly damaging Het
Cadps G A 14: 12,491,778 Q791* probably null Het
Cdc14b T C 13: 64,216,209 probably null Het
Cep89 C T 7: 35,398,047 P33S probably damaging Het
Clec18a A G 8: 111,081,029 probably benign Het
Cln5 T A 14: 103,076,201 D296E probably benign Het
Col6a4 A T 9: 106,066,703 S1191T probably benign Het
Crispld1 A G 1: 17,762,231 I480M probably damaging Het
Dhrs7 A C 12: 72,664,659 L32V probably damaging Het
Dscam T C 16: 96,622,811 T1645A probably benign Het
Eif2b3 A G 4: 117,028,425 T55A possibly damaging Het
Ercc6 T C 14: 32,517,110 Y52H probably benign Het
Fam170b C A 14: 32,836,071 Q288K unknown Het
Flt4 A G 11: 49,630,578 T442A probably benign Het
Gm19402 A T 10: 77,690,061 probably benign Het
Gm4841 A G 18: 60,270,760 I87T probably damaging Het
Hspb7 A G 4: 141,422,549 E82G possibly damaging Het
Itgb3 A G 11: 104,665,582 K750E possibly damaging Het
Itsn2 A G 12: 4,629,655 M155V probably benign Het
March8 A T 6: 116,402,101 D332V probably null Het
Mst1r A G 9: 107,915,853 M1042V probably benign Het
Muc4 T C 16: 32,767,351 F2756L probably benign Het
Myl6b T A 10: 128,497,209 K55* probably null Het
Olfr1230 A T 2: 89,296,646 I208N probably damaging Het
Olfr150 A C 9: 39,737,672 N286H probably damaging Het
Olfr348 A G 2: 36,786,780 N85S probably damaging Het
Olfr830 T C 9: 18,875,731 Y132H probably damaging Het
Pcca A G 14: 122,638,382 D141G probably benign Het
Pkd2 C T 5: 104,486,680 R526* probably null Het
Polr2a C A 11: 69,743,337 A756S probably damaging Het
Prkd2 T C 7: 16,847,654 S145P probably damaging Het
Rhbdf1 T C 11: 32,212,915 N451D possibly damaging Het
Rundc3a G A 11: 102,400,795 R358Q probably damaging Het
Tbc1d4 T C 14: 101,507,174 K339E probably damaging Het
Usp37 A G 1: 74,453,893 I723T probably benign Het
Vwa2 A T 19: 56,901,526 probably null Het
Zdbf2 A C 1: 63,303,321 R286S possibly damaging Het
Zfp422 G A 6: 116,626,820 H73Y probably damaging Het
Zfp868 T C 8: 69,611,913 H257R probably damaging Het
Zzef1 A G 11: 72,884,349 S1723G possibly damaging Het
Other mutations in Olfr1301
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Olfr1301 APN 2 111754426 missense probably damaging 1.00
IGL01396:Olfr1301 APN 2 111754603 missense probably damaging 1.00
IGL01396:Olfr1301 APN 2 111754503 missense probably benign 0.01
IGL01538:Olfr1301 APN 2 111755005 missense probably damaging 0.98
IGL01795:Olfr1301 APN 2 111754386 missense probably benign 0.00
IGL02007:Olfr1301 APN 2 111754479 missense probably damaging 0.99
IGL02738:Olfr1301 APN 2 111754354 missense probably damaging 1.00
IGL03365:Olfr1301 APN 2 111754427 missense possibly damaging 0.95
R0014:Olfr1301 UTSW 2 111754774 missense probably damaging 1.00
R0115:Olfr1301 UTSW 2 111754585 missense probably damaging 1.00
R0481:Olfr1301 UTSW 2 111754585 missense probably damaging 1.00
R1441:Olfr1301 UTSW 2 111755002 missense probably damaging 1.00
R1583:Olfr1301 UTSW 2 111754425 missense probably damaging 0.98
R2091:Olfr1301 UTSW 2 111754386 missense probably benign 0.00
R2301:Olfr1301 UTSW 2 111754276 missense probably benign 0.01
R2363:Olfr1301 UTSW 2 111754794 missense probably damaging 0.97
R2511:Olfr1301 UTSW 2 111754316 missense probably benign 0.00
R3686:Olfr1301 UTSW 2 111754569 missense probably benign 0.00
R4841:Olfr1301 UTSW 2 111754334 missense probably benign 0.00
R4915:Olfr1301 UTSW 2 111754380 missense probably benign 0.00
R4961:Olfr1301 UTSW 2 111754405 missense probably damaging 1.00
R5123:Olfr1301 UTSW 2 111754552 missense probably damaging 1.00
R5417:Olfr1301 UTSW 2 111754920 missense possibly damaging 0.50
R5654:Olfr1301 UTSW 2 111754981 missense probably damaging 1.00
R5753:Olfr1301 UTSW 2 111754801 missense possibly damaging 0.51
R6525:Olfr1301 UTSW 2 111754984 missense probably benign 0.09
R6682:Olfr1301 UTSW 2 111754635 missense probably damaging 1.00
R7099:Olfr1301 UTSW 2 111755076 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GACAAGAATCTCCATTCTCCCATG -3'
(R):5'- GGGAATCCATGCAAGCTAGC -3'

Sequencing Primer
(F):5'- ATGTACTTCTTTTTGGCCAACCTG -3'
(R):5'- CTGTCAATTTCCATATGACCACAGAG -3'
Posted On2018-04-27