Incidental Mutation 'R6361:Eif2b3'
ID513110
Institutional Source Beutler Lab
Gene Symbol Eif2b3
Ensembl Gene ENSMUSG00000028683
Gene Nameeukaryotic translation initiation factor 2B, subunit 3
Synonyms1190002P15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6361 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location117019402-117087306 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 117028425 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 55 (T55A)
Ref Sequence ENSEMBL: ENSMUSP00000102055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070610] [ENSMUST00000106447] [ENSMUST00000106448]
Predicted Effect possibly damaging
Transcript: ENSMUST00000070610
AA Change: T55A

PolyPhen 2 Score 0.658 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000070334
Gene: ENSMUSG00000028683
AA Change: T55A

DomainStartEndE-ValueType
Pfam:NTP_transferase 4 139 8.2e-20 PFAM
Pfam:NTP_transf_3 5 226 8.5e-19 PFAM
low complexity region 247 262 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106447
AA Change: T55A

PolyPhen 2 Score 0.658 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000102055
Gene: ENSMUSG00000028683
AA Change: T55A

DomainStartEndE-ValueType
Pfam:NTP_transferase 4 139 1.1e-19 PFAM
Pfam:NTP_transf_3 5 221 1.7e-18 PFAM
low complexity region 247 262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106448
AA Change: T55A

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000102056
Gene: ENSMUSG00000028683
AA Change: T55A

DomainStartEndE-ValueType
Pfam:NTP_transferase 4 140 3.2e-19 PFAM
Pfam:NTP_transf_3 5 237 3.7e-18 PFAM
low complexity region 247 262 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157724
Meta Mutation Damage Score 0.0780 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the subunits of initiation factor eIF2B, which catalyzes the exchange of eukaryotic initiation factor 2-bound GDP for GTP. It has also been found to function as a cofactor of hepatitis C virus internal ribosome entry site-mediated translation. Mutations in this gene have been associated with leukodystrophy with vanishing white matter. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A T 4: 42,972,695 D676V probably benign Het
6430531B16Rik T A 7: 139,976,672 D134V possibly damaging Het
Asap1 C T 15: 64,349,823 probably null Het
Cabin1 G A 10: 75,726,865 A29V possibly damaging Het
Cadps G A 14: 12,491,778 Q791* probably null Het
Cdc14b T C 13: 64,216,209 probably null Het
Cep89 C T 7: 35,398,047 P33S probably damaging Het
Clec18a A G 8: 111,081,029 probably benign Het
Cln5 T A 14: 103,076,201 D296E probably benign Het
Col6a4 A T 9: 106,066,703 S1191T probably benign Het
Crispld1 A G 1: 17,762,231 I480M probably damaging Het
Dhrs7 A C 12: 72,664,659 L32V probably damaging Het
Dscam T C 16: 96,622,811 T1645A probably benign Het
Ercc6 T C 14: 32,517,110 Y52H probably benign Het
Fam170b C A 14: 32,836,071 Q288K unknown Het
Flt4 A G 11: 49,630,578 T442A probably benign Het
Gm19402 A T 10: 77,690,061 probably benign Het
Gm4841 A G 18: 60,270,760 I87T probably damaging Het
Hspb7 A G 4: 141,422,549 E82G possibly damaging Het
Itgb3 A G 11: 104,665,582 K750E possibly damaging Het
Itsn2 A G 12: 4,629,655 M155V probably benign Het
March8 A T 6: 116,402,101 D332V probably null Het
Mst1r A G 9: 107,915,853 M1042V probably benign Het
Muc4 T C 16: 32,767,351 F2756L probably benign Het
Myl6b T A 10: 128,497,209 K55* probably null Het
Olfr1230 A T 2: 89,296,646 I208N probably damaging Het
Olfr1301 G T 2: 111,754,595 L115F probably damaging Het
Olfr150 A C 9: 39,737,672 N286H probably damaging Het
Olfr348 A G 2: 36,786,780 N85S probably damaging Het
Olfr830 T C 9: 18,875,731 Y132H probably damaging Het
Pcca A G 14: 122,638,382 D141G probably benign Het
Pkd2 C T 5: 104,486,680 R526* probably null Het
Polr2a C A 11: 69,743,337 A756S probably damaging Het
Prkd2 T C 7: 16,847,654 S145P probably damaging Het
Rhbdf1 T C 11: 32,212,915 N451D possibly damaging Het
Rundc3a G A 11: 102,400,795 R358Q probably damaging Het
Tbc1d4 T C 14: 101,507,174 K339E probably damaging Het
Usp37 A G 1: 74,453,893 I723T probably benign Het
Vwa2 A T 19: 56,901,526 probably null Het
Zdbf2 A C 1: 63,303,321 R286S possibly damaging Het
Zfp422 G A 6: 116,626,820 H73Y probably damaging Het
Zfp868 T C 8: 69,611,913 H257R probably damaging Het
Zzef1 A G 11: 72,884,349 S1723G possibly damaging Het
Other mutations in Eif2b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Eif2b3 APN 4 117066469 missense probably benign
IGL01333:Eif2b3 APN 4 117070690 missense probably benign 0.31
IGL01564:Eif2b3 APN 4 117028542 missense probably benign 0.00
IGL01721:Eif2b3 APN 4 117058804 missense probably damaging 1.00
IGL02061:Eif2b3 APN 4 117028411 missense possibly damaging 0.78
R0835:Eif2b3 UTSW 4 117058805 missense probably damaging 1.00
R0924:Eif2b3 UTSW 4 117081578 missense possibly damaging 0.93
R2167:Eif2b3 UTSW 4 117028540 missense probably damaging 1.00
R2424:Eif2b3 UTSW 4 117070848 missense probably benign 0.01
R3902:Eif2b3 UTSW 4 117022207 missense probably damaging 1.00
R4105:Eif2b3 UTSW 4 117081634 missense probably damaging 1.00
R4688:Eif2b3 UTSW 4 117058849 missense probably benign 0.03
R4998:Eif2b3 UTSW 4 117066392 missense probably benign 0.06
R5033:Eif2b3 UTSW 4 117052736 missense probably damaging 1.00
R5123:Eif2b3 UTSW 4 117022211 missense probably damaging 1.00
R5493:Eif2b3 UTSW 4 117086722 missense possibly damaging 0.92
R5787:Eif2b3 UTSW 4 117044440 missense probably damaging 1.00
R5789:Eif2b3 UTSW 4 117028495 missense probably damaging 1.00
R6347:Eif2b3 UTSW 4 117044566 missense probably benign 0.05
R6643:Eif2b3 UTSW 4 117070757 missense probably damaging 0.97
R6798:Eif2b3 UTSW 4 117066458 missense probably benign 0.00
R7299:Eif2b3 UTSW 4 117052822 missense probably benign 0.27
R7301:Eif2b3 UTSW 4 117052822 missense probably benign 0.27
R7451:Eif2b3 UTSW 4 117052796 nonsense probably null
R8117:Eif2b3 UTSW 4 117022217 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGGCTCAGTCATATTAGCATTTATCAT -3'
(R):5'- ACATACAAAGCACTGTCAAATAAGAT -3'

Sequencing Primer
(F):5'- GATTCTATACGCTGGCTTTGAAC -3'
(R):5'- AATCTGCAGTCCCCATGT -3'
Posted On2018-04-27