Incidental Mutation 'R6361:Hspb7'
ID513111
Institutional Source Beutler Lab
Gene Symbol Hspb7
Ensembl Gene ENSMUSG00000006221
Gene Nameheat shock protein family, member 7 (cardiovascular)
SynonymsHsp25-2, cvHsp
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R6361 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location141420779-141425311 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 141422549 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 82 (E82G)
Ref Sequence ENSEMBL: ENSMUSP00000099544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102486]
Predicted Effect possibly damaging
Transcript: ENSMUST00000102486
AA Change: E82G

PolyPhen 2 Score 0.473 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099544
Gene: ENSMUSG00000006221
AA Change: E82G

DomainStartEndE-ValueType
low complexity region 6 32 N/A INTRINSIC
Pfam:HSP20 73 168 8.6e-16 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency 98% (43/44)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele show embryonic lethality during organogenesis and defects in heart development associated with increased thin filament length and formation of atypical actin filament bundles in cardiomyocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A T 4: 42,972,695 D676V probably benign Het
6430531B16Rik T A 7: 139,976,672 D134V possibly damaging Het
Asap1 C T 15: 64,349,823 probably null Het
Cabin1 G A 10: 75,726,865 A29V possibly damaging Het
Cadps G A 14: 12,491,778 Q791* probably null Het
Cdc14b T C 13: 64,216,209 probably null Het
Cep89 C T 7: 35,398,047 P33S probably damaging Het
Clec18a A G 8: 111,081,029 probably benign Het
Cln5 T A 14: 103,076,201 D296E probably benign Het
Col6a4 A T 9: 106,066,703 S1191T probably benign Het
Crispld1 A G 1: 17,762,231 I480M probably damaging Het
Dhrs7 A C 12: 72,664,659 L32V probably damaging Het
Dscam T C 16: 96,622,811 T1645A probably benign Het
Eif2b3 A G 4: 117,028,425 T55A possibly damaging Het
Ercc6 T C 14: 32,517,110 Y52H probably benign Het
Fam170b C A 14: 32,836,071 Q288K unknown Het
Flt4 A G 11: 49,630,578 T442A probably benign Het
Gm19402 A T 10: 77,690,061 probably benign Het
Gm4841 A G 18: 60,270,760 I87T probably damaging Het
Itgb3 A G 11: 104,665,582 K750E possibly damaging Het
Itsn2 A G 12: 4,629,655 M155V probably benign Het
March8 A T 6: 116,402,101 D332V probably null Het
Mst1r A G 9: 107,915,853 M1042V probably benign Het
Muc4 T C 16: 32,767,351 F2756L probably benign Het
Myl6b T A 10: 128,497,209 K55* probably null Het
Olfr1230 A T 2: 89,296,646 I208N probably damaging Het
Olfr1301 G T 2: 111,754,595 L115F probably damaging Het
Olfr150 A C 9: 39,737,672 N286H probably damaging Het
Olfr348 A G 2: 36,786,780 N85S probably damaging Het
Olfr830 T C 9: 18,875,731 Y132H probably damaging Het
Pcca A G 14: 122,638,382 D141G probably benign Het
Pkd2 C T 5: 104,486,680 R526* probably null Het
Polr2a C A 11: 69,743,337 A756S probably damaging Het
Prkd2 T C 7: 16,847,654 S145P probably damaging Het
Rhbdf1 T C 11: 32,212,915 N451D possibly damaging Het
Rundc3a G A 11: 102,400,795 R358Q probably damaging Het
Tbc1d4 T C 14: 101,507,174 K339E probably damaging Het
Usp37 A G 1: 74,453,893 I723T probably benign Het
Vwa2 A T 19: 56,901,526 probably null Het
Zdbf2 A C 1: 63,303,321 R286S possibly damaging Het
Zfp422 G A 6: 116,626,820 H73Y probably damaging Het
Zfp868 T C 8: 69,611,913 H257R probably damaging Het
Zzef1 A G 11: 72,884,349 S1723G possibly damaging Het
Other mutations in Hspb7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02504:Hspb7 APN 4 141421820 missense probably benign 0.33
IGL03388:Hspb7 APN 4 141424045 missense probably damaging 1.00
R0042:Hspb7 UTSW 4 141423934 missense probably damaging 0.99
R0077:Hspb7 UTSW 4 141424047 missense probably damaging 0.97
R0147:Hspb7 UTSW 4 141423991 missense probably damaging 1.00
R0148:Hspb7 UTSW 4 141423991 missense probably damaging 1.00
R4368:Hspb7 UTSW 4 141424018 missense probably damaging 0.98
R4717:Hspb7 UTSW 4 141422585 missense probably damaging 1.00
R6039:Hspb7 UTSW 4 141423904 missense probably damaging 0.98
R6039:Hspb7 UTSW 4 141423904 missense probably damaging 0.98
R6165:Hspb7 UTSW 4 141422551 missense probably benign 0.26
R7087:Hspb7 UTSW 4 141422555 missense possibly damaging 0.88
X0026:Hspb7 UTSW 4 141424027 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GACACAGATTGAGGTGCGTG -3'
(R):5'- ACATAAATCAGGGTACGAAGCC -3'

Sequencing Primer
(F):5'- ATTGAGGTGCGTGAGGCTCAC -3'
(R):5'- TACGAAGCCTACAAAGATAGGG -3'
Posted On2018-04-27