Incidental Mutation 'R6361:March8'
ID513113
Institutional Source Beutler Lab
Gene Symbol March8
Ensembl Gene ENSMUSG00000025702
Gene Namemembrane-associated ring finger (C3HC4) 8
Synonyms1300017E09Rik, Mir
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock #R6361 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location116338024-116409540 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 116402101 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 332 (D332V)
Ref Sequence ENSEMBL: ENSMUSP00000144936 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079012] [ENSMUST00000101032] [ENSMUST00000123405] [ENSMUST00000135901] [ENSMUST00000140884] [ENSMUST00000203116] [ENSMUST00000203193] [ENSMUST00000204657]
Predicted Effect probably benign
Transcript: ENSMUST00000079012
SMART Domains Protein: ENSMUSP00000078024
Gene: ENSMUSG00000025702

DomainStartEndE-ValueType
low complexity region 47 64 N/A INTRINSIC
RINGv 75 123 1.16e-23 SMART
transmembrane domain 151 173 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101032
SMART Domains Protein: ENSMUSP00000098594
Gene: ENSMUSG00000025702

DomainStartEndE-ValueType
low complexity region 47 64 N/A INTRINSIC
RINGv 75 123 1.16e-23 SMART
transmembrane domain 151 173 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123246
Predicted Effect probably null
Transcript: ENSMUST00000123405
AA Change: D332V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144936
Gene: ENSMUSG00000025702
AA Change: D332V

DomainStartEndE-ValueType
low complexity region 47 64 N/A INTRINSIC
low complexity region 258 270 N/A INTRINSIC
RINGv 357 405 2.4e-25 SMART
transmembrane domain 433 455 N/A INTRINSIC
transmembrane domain 475 497 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127992
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130445
Predicted Effect probably benign
Transcript: ENSMUST00000135901
SMART Domains Protein: ENSMUSP00000115510
Gene: ENSMUSG00000025702

DomainStartEndE-ValueType
low complexity region 43 60 N/A INTRINSIC
RINGv 71 119 1.16e-23 SMART
transmembrane domain 147 169 N/A INTRINSIC
transmembrane domain 184 206 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140884
SMART Domains Protein: ENSMUSP00000145060
Gene: ENSMUSG00000025702

DomainStartEndE-ValueType
low complexity region 47 64 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156014
Predicted Effect probably benign
Transcript: ENSMUST00000203116
Predicted Effect probably benign
Transcript: ENSMUST00000203193
SMART Domains Protein: ENSMUSP00000145137
Gene: ENSMUSG00000025702

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
RINGv 36 84 2.9e-26 SMART
transmembrane domain 112 134 N/A INTRINSIC
transmembrane domain 149 171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204657
SMART Domains Protein: ENSMUSP00000145351
Gene: ENSMUSG00000025702

DomainStartEndE-ValueType
low complexity region 47 64 N/A INTRINSIC
RINGv 75 123 2.9e-26 SMART
transmembrane domain 151 173 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204918
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the membrane-associated really interesting new gene-CH family of proteins. These proteins are E3 ubiquitin-protein ligases that modulate antigen presentation by downregulating major histocompatibility complex class II surface expression through endocytosis. The transcript is primarily expressed by dendritic cells and macrophages. Overexpression of this gene in antigen presenting cells results in immune defective phenotypes, including resistance to autoimmune disease onset. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a normal CD4+ T cell compartment in the thymus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A T 4: 42,972,695 D676V probably benign Het
6430531B16Rik T A 7: 139,976,672 D134V possibly damaging Het
Asap1 C T 15: 64,349,823 probably null Het
Cabin1 G A 10: 75,726,865 A29V possibly damaging Het
Cadps G A 14: 12,491,778 Q791* probably null Het
Cdc14b T C 13: 64,216,209 probably null Het
Cep89 C T 7: 35,398,047 P33S probably damaging Het
Clec18a A G 8: 111,081,029 probably benign Het
Cln5 T A 14: 103,076,201 D296E probably benign Het
Col6a4 A T 9: 106,066,703 S1191T probably benign Het
Crispld1 A G 1: 17,762,231 I480M probably damaging Het
Dhrs7 A C 12: 72,664,659 L32V probably damaging Het
Dscam T C 16: 96,622,811 T1645A probably benign Het
Eif2b3 A G 4: 117,028,425 T55A possibly damaging Het
Ercc6 T C 14: 32,517,110 Y52H probably benign Het
Fam170b C A 14: 32,836,071 Q288K unknown Het
Flt4 A G 11: 49,630,578 T442A probably benign Het
Gm19402 A T 10: 77,690,061 probably benign Het
Gm4841 A G 18: 60,270,760 I87T probably damaging Het
Hspb7 A G 4: 141,422,549 E82G possibly damaging Het
Itgb3 A G 11: 104,665,582 K750E possibly damaging Het
Itsn2 A G 12: 4,629,655 M155V probably benign Het
Mst1r A G 9: 107,915,853 M1042V probably benign Het
Muc4 T C 16: 32,767,351 F2756L probably benign Het
Myl6b T A 10: 128,497,209 K55* probably null Het
Olfr1230 A T 2: 89,296,646 I208N probably damaging Het
Olfr1301 G T 2: 111,754,595 L115F probably damaging Het
Olfr150 A C 9: 39,737,672 N286H probably damaging Het
Olfr348 A G 2: 36,786,780 N85S probably damaging Het
Olfr830 T C 9: 18,875,731 Y132H probably damaging Het
Pcca A G 14: 122,638,382 D141G probably benign Het
Pkd2 C T 5: 104,486,680 R526* probably null Het
Polr2a C A 11: 69,743,337 A756S probably damaging Het
Prkd2 T C 7: 16,847,654 S145P probably damaging Het
Rhbdf1 T C 11: 32,212,915 N451D possibly damaging Het
Rundc3a G A 11: 102,400,795 R358Q probably damaging Het
Tbc1d4 T C 14: 101,507,174 K339E probably damaging Het
Usp37 A G 1: 74,453,893 I723T probably benign Het
Vwa2 A T 19: 56,901,526 probably null Het
Zdbf2 A C 1: 63,303,321 R286S possibly damaging Het
Zfp422 G A 6: 116,626,820 H73Y probably damaging Het
Zfp868 T C 8: 69,611,913 H257R probably damaging Het
Zzef1 A G 11: 72,884,349 S1723G possibly damaging Het
Other mutations in March8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02966:March8 APN 6 116403538 missense probably damaging 1.00
strider UTSW 6 116402043 missense probably benign
R0828:March8 UTSW 6 116405678 missense probably benign 0.36
R2869:March8 UTSW 6 116401145 intron probably benign
R2870:March8 UTSW 6 116401145 intron probably benign
R4963:March8 UTSW 6 116386271 intron probably benign
R5617:March8 UTSW 6 116403520 missense possibly damaging 0.55
R6329:March8 UTSW 6 116406316 missense possibly damaging 0.78
R6615:March8 UTSW 6 116405663 missense probably damaging 1.00
R6771:March8 UTSW 6 116402043 missense probably benign
R7014:March8 UTSW 6 116403543 missense probably damaging 1.00
R7014:March8 UTSW 6 116403544 missense probably damaging 1.00
R7249:March8 UTSW 6 116406234 missense probably benign 0.17
R7558:March8 UTSW 6 116403565 missense possibly damaging 0.89
R8218:March8 UTSW 6 116338098 start gained probably benign
Z1177:March8 UTSW 6 116338272 intron probably benign
Predicted Primers PCR Primer
(F):5'- CTCAAGTGCCAGTAGCCTACATAG -3'
(R):5'- TGGCAACAGATGTCTTGCTAC -3'

Sequencing Primer
(F):5'- GTAGCCTACATAGGTTCCATGAGC -3'
(R):5'- GGCAACAGATGTCTTGCTACTTCAC -3'
Posted On2018-04-27