Incidental Mutation 'R6361:Zfp422'
ID513114
Institutional Source Beutler Lab
Gene Symbol Zfp422
Ensembl Gene ENSMUSG00000059878
Gene Namezinc finger protein 422
SynonymsKrox26, 2900028O21Rik, Krox-26, Krox25, KOX15, Krox-25-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6361 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location116624016-116628999 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 116626820 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 73 (H73Y)
Ref Sequence ENSEMBL: ENSMUSP00000108501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057540] [ENSMUST00000079749] [ENSMUST00000112880]
Predicted Effect probably damaging
Transcript: ENSMUST00000057540
AA Change: H73Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000084926
Gene: ENSMUSG00000059878
AA Change: H73Y

DomainStartEndE-ValueType
ZnF_C2H2 55 77 6.32e-3 SMART
ZnF_C2H2 83 105 6.32e-3 SMART
ZnF_C2H2 111 133 1.06e-4 SMART
ZnF_C2H2 139 161 2.53e-2 SMART
ZnF_C2H2 167 189 2.12e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000079749
AA Change: H73Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078685
Gene: ENSMUSG00000059878
AA Change: H73Y

DomainStartEndE-ValueType
ZnF_C2H2 55 77 6.32e-3 SMART
ZnF_C2H2 83 105 6.32e-3 SMART
ZnF_C2H2 111 133 1.06e-4 SMART
ZnF_C2H2 139 161 2.53e-2 SMART
ZnF_C2H2 167 189 2.12e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112880
AA Change: H73Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108501
Gene: ENSMUSG00000059878
AA Change: H73Y

DomainStartEndE-ValueType
ZnF_C2H2 55 77 6.32e-3 SMART
ZnF_C2H2 83 105 6.32e-3 SMART
ZnF_C2H2 111 133 1.06e-4 SMART
ZnF_C2H2 139 161 2.53e-2 SMART
ZnF_C2H2 167 189 2.12e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203788
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204557
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204559
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: This gene encodes a putative C2H2 zinc finger transcription factor that may play a role in tooth development. A pseudogene related to this gene is located on chromosome 17. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A T 4: 42,972,695 D676V probably benign Het
6430531B16Rik T A 7: 139,976,672 D134V possibly damaging Het
Asap1 C T 15: 64,349,823 probably null Het
Cabin1 G A 10: 75,726,865 A29V possibly damaging Het
Cadps G A 14: 12,491,778 Q791* probably null Het
Cdc14b T C 13: 64,216,209 probably null Het
Cep89 C T 7: 35,398,047 P33S probably damaging Het
Clec18a A G 8: 111,081,029 probably benign Het
Cln5 T A 14: 103,076,201 D296E probably benign Het
Col6a4 A T 9: 106,066,703 S1191T probably benign Het
Crispld1 A G 1: 17,762,231 I480M probably damaging Het
Dhrs7 A C 12: 72,664,659 L32V probably damaging Het
Dscam T C 16: 96,622,811 T1645A probably benign Het
Eif2b3 A G 4: 117,028,425 T55A possibly damaging Het
Ercc6 T C 14: 32,517,110 Y52H probably benign Het
Fam170b C A 14: 32,836,071 Q288K unknown Het
Flt4 A G 11: 49,630,578 T442A probably benign Het
Gm19402 A T 10: 77,690,061 probably benign Het
Gm4841 A G 18: 60,270,760 I87T probably damaging Het
Hspb7 A G 4: 141,422,549 E82G possibly damaging Het
Itgb3 A G 11: 104,665,582 K750E possibly damaging Het
Itsn2 A G 12: 4,629,655 M155V probably benign Het
March8 A T 6: 116,402,101 D332V probably null Het
Mst1r A G 9: 107,915,853 M1042V probably benign Het
Muc4 T C 16: 32,767,351 F2756L probably benign Het
Myl6b T A 10: 128,497,209 K55* probably null Het
Olfr1230 A T 2: 89,296,646 I208N probably damaging Het
Olfr1301 G T 2: 111,754,595 L115F probably damaging Het
Olfr150 A C 9: 39,737,672 N286H probably damaging Het
Olfr348 A G 2: 36,786,780 N85S probably damaging Het
Olfr830 T C 9: 18,875,731 Y132H probably damaging Het
Pcca A G 14: 122,638,382 D141G probably benign Het
Pkd2 C T 5: 104,486,680 R526* probably null Het
Polr2a C A 11: 69,743,337 A756S probably damaging Het
Prkd2 T C 7: 16,847,654 S145P probably damaging Het
Rhbdf1 T C 11: 32,212,915 N451D possibly damaging Het
Rundc3a G A 11: 102,400,795 R358Q probably damaging Het
Tbc1d4 T C 14: 101,507,174 K339E probably damaging Het
Usp37 A G 1: 74,453,893 I723T probably benign Het
Vwa2 A T 19: 56,901,526 probably null Het
Zdbf2 A C 1: 63,303,321 R286S possibly damaging Het
Zfp868 T C 8: 69,611,913 H257R probably damaging Het
Zzef1 A G 11: 72,884,349 S1723G possibly damaging Het
Other mutations in Zfp422
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Zfp422 APN 6 116626958 missense probably benign 0.00
IGL00659:Zfp422 APN 6 116626505 nonsense probably null
IGL03199:Zfp422 APN 6 116626951 missense probably benign 0.43
R0190:Zfp422 UTSW 6 116626611 missense probably damaging 1.00
R1572:Zfp422 UTSW 6 116626784 missense probably damaging 1.00
R1756:Zfp422 UTSW 6 116626424 missense probably benign 0.00
R2290:Zfp422 UTSW 6 116626642 missense possibly damaging 0.74
R3724:Zfp422 UTSW 6 116626379 missense probably benign 0.00
R3932:Zfp422 UTSW 6 116626459 missense probably benign 0.00
R3933:Zfp422 UTSW 6 116626459 missense probably benign 0.00
R4700:Zfp422 UTSW 6 116626883 missense possibly damaging 0.59
R4806:Zfp422 UTSW 6 116626662 missense probably damaging 1.00
R4957:Zfp422 UTSW 6 116626943 nonsense probably null
R5784:Zfp422 UTSW 6 116626810 missense probably damaging 1.00
R8303:Zfp422 UTSW 6 116626651 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCATGTGCTGCCTCAGATG -3'
(R):5'- TATTTCTCGAAGCGCCAGC -3'

Sequencing Primer
(F):5'- TCATCACAGCAGTAGGGCTTC -3'
(R):5'- GCGCCAGCCAAGGAAAAGC -3'
Posted On2018-04-27