Incidental Mutation 'R6361:Prkd2'
ID513115
Institutional Source Beutler Lab
Gene Symbol Prkd2
Ensembl Gene ENSMUSG00000041187
Gene Nameprotein kinase D2
SynonymsPKD2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6361 (G1)
Quality Score202.009
Status Validated
Chromosome7
Chromosomal Location16842902-16870464 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 16847654 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 145 (S145P)
Ref Sequence ENSEMBL: ENSMUSP00000131192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086104] [ENSMUST00000168093]
Predicted Effect probably damaging
Transcript: ENSMUST00000086104
AA Change: S145P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083273
Gene: ENSMUSG00000041187
AA Change: S145P

DomainStartEndE-ValueType
low complexity region 2 43 N/A INTRINSIC
C1 139 188 2.87e-11 SMART
C1 266 315 1.28e-17 SMART
low complexity region 353 373 N/A INTRINSIC
PH 399 512 2.07e-6 SMART
S_TKc 552 808 6.12e-92 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168093
AA Change: S145P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131192
Gene: ENSMUSG00000041187
AA Change: S145P

DomainStartEndE-ValueType
low complexity region 2 43 N/A INTRINSIC
C1 139 188 2.87e-11 SMART
C1 266 315 1.28e-17 SMART
low complexity region 353 373 N/A INTRINSIC
PH 399 512 2.07e-6 SMART
S_TKc 552 808 6.12e-92 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205386
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205456
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205841
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205999
Meta Mutation Damage Score 0.9297 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the protein kinase D (PKD) family of serine/threonine protein kinases. This kinase can be activated by phorbol esters as well as by gastrin via the cholecystokinin B receptor (CCKBR) in gastric cancer cells. It can bind to diacylglycerol (DAG) in the trans-Golgi network (TGN) and may regulate basolateral membrane protein exit from TGN. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit impaired IgM and IgG1 antigen responses and CD4+ and CD8+ T cell production of IL2 and IFN-gamma in response to TCR stimulation. Mice homozygous for a gene trap allele exhibit normal T lymphocyte maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A T 4: 42,972,695 D676V probably benign Het
6430531B16Rik T A 7: 139,976,672 D134V possibly damaging Het
Asap1 C T 15: 64,349,823 probably null Het
Cabin1 G A 10: 75,726,865 A29V possibly damaging Het
Cadps G A 14: 12,491,778 Q791* probably null Het
Cdc14b T C 13: 64,216,209 probably null Het
Cep89 C T 7: 35,398,047 P33S probably damaging Het
Clec18a A G 8: 111,081,029 probably benign Het
Cln5 T A 14: 103,076,201 D296E probably benign Het
Col6a4 A T 9: 106,066,703 S1191T probably benign Het
Crispld1 A G 1: 17,762,231 I480M probably damaging Het
Dhrs7 A C 12: 72,664,659 L32V probably damaging Het
Dscam T C 16: 96,622,811 T1645A probably benign Het
Eif2b3 A G 4: 117,028,425 T55A possibly damaging Het
Ercc6 T C 14: 32,517,110 Y52H probably benign Het
Fam170b C A 14: 32,836,071 Q288K unknown Het
Flt4 A G 11: 49,630,578 T442A probably benign Het
Gm19402 A T 10: 77,690,061 probably benign Het
Gm4841 A G 18: 60,270,760 I87T probably damaging Het
Hspb7 A G 4: 141,422,549 E82G possibly damaging Het
Itgb3 A G 11: 104,665,582 K750E possibly damaging Het
Itsn2 A G 12: 4,629,655 M155V probably benign Het
March8 A T 6: 116,402,101 D332V probably null Het
Mst1r A G 9: 107,915,853 M1042V probably benign Het
Muc4 T C 16: 32,767,351 F2756L probably benign Het
Myl6b T A 10: 128,497,209 K55* probably null Het
Olfr1230 A T 2: 89,296,646 I208N probably damaging Het
Olfr1301 G T 2: 111,754,595 L115F probably damaging Het
Olfr150 A C 9: 39,737,672 N286H probably damaging Het
Olfr348 A G 2: 36,786,780 N85S probably damaging Het
Olfr830 T C 9: 18,875,731 Y132H probably damaging Het
Pcca A G 14: 122,638,382 D141G probably benign Het
Pkd2 C T 5: 104,486,680 R526* probably null Het
Polr2a C A 11: 69,743,337 A756S probably damaging Het
Rhbdf1 T C 11: 32,212,915 N451D possibly damaging Het
Rundc3a G A 11: 102,400,795 R358Q probably damaging Het
Tbc1d4 T C 14: 101,507,174 K339E probably damaging Het
Usp37 A G 1: 74,453,893 I723T probably benign Het
Vwa2 A T 19: 56,901,526 probably null Het
Zdbf2 A C 1: 63,303,321 R286S possibly damaging Het
Zfp422 G A 6: 116,626,820 H73Y probably damaging Het
Zfp868 T C 8: 69,611,913 H257R probably damaging Het
Zzef1 A G 11: 72,884,349 S1723G possibly damaging Het
Other mutations in Prkd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Prkd2 APN 7 16865862 missense probably damaging 1.00
IGL01138:Prkd2 APN 7 16848811 missense probably damaging 1.00
IGL01714:Prkd2 APN 7 16863942 missense probably damaging 1.00
IGL01968:Prkd2 APN 7 16869576 splice site probably null
IGL01969:Prkd2 APN 7 16865757 missense probably damaging 1.00
IGL02354:Prkd2 APN 7 16847658 missense probably damaging 1.00
IGL02361:Prkd2 APN 7 16847658 missense probably damaging 1.00
IGL02504:Prkd2 APN 7 16857832 missense probably damaging 1.00
IGL02804:Prkd2 APN 7 16855890 missense probably benign 0.04
IGL02834:Prkd2 APN 7 16845934 missense probably damaging 0.97
IGL02962:Prkd2 APN 7 16869832 missense probably benign 0.01
IGL03053:Prkd2 APN 7 16850263 missense possibly damaging 0.63
IGL03168:Prkd2 APN 7 16850263 missense possibly damaging 0.63
alila UTSW 7 16847654 missense probably damaging 1.00
Beaches UTSW 7 16849203 nonsense probably null
Purnama UTSW 7 16869565 missense probably damaging 1.00
Sandals UTSW 7 16865714 missense probably damaging 1.00
R0024:Prkd2 UTSW 7 16847643 missense probably damaging 1.00
R0173:Prkd2 UTSW 7 16849044 missense probably benign
R0190:Prkd2 UTSW 7 16869890 missense probably damaging 1.00
R0834:Prkd2 UTSW 7 16865677 splice site probably benign
R1418:Prkd2 UTSW 7 16869545 missense probably benign 0.03
R1488:Prkd2 UTSW 7 16858439 missense probably damaging 1.00
R1648:Prkd2 UTSW 7 16857807 missense possibly damaging 0.51
R2015:Prkd2 UTSW 7 16847677 nonsense probably null
R2042:Prkd2 UTSW 7 16856268 missense possibly damaging 0.86
R2101:Prkd2 UTSW 7 16869565 missense probably damaging 1.00
R3884:Prkd2 UTSW 7 16853255 missense probably benign 0.02
R4601:Prkd2 UTSW 7 16843648 unclassified probably benign
R4979:Prkd2 UTSW 7 16848727 missense probably damaging 1.00
R5240:Prkd2 UTSW 7 16855786 missense probably benign 0.09
R5643:Prkd2 UTSW 7 16843792 missense probably benign 0.02
R5994:Prkd2 UTSW 7 16850336 missense probably benign 0.00
R6033:Prkd2 UTSW 7 16865714 missense probably damaging 1.00
R6033:Prkd2 UTSW 7 16865714 missense probably damaging 1.00
R6738:Prkd2 UTSW 7 16865905 missense possibly damaging 0.64
R6798:Prkd2 UTSW 7 16849203 nonsense probably null
R6815:Prkd2 UTSW 7 16843793 missense probably benign 0.00
R7241:Prkd2 UTSW 7 16857805 missense probably benign 0.44
R7293:Prkd2 UTSW 7 16845940 missense possibly damaging 0.88
R7323:Prkd2 UTSW 7 16847622 missense probably benign 0.07
R7900:Prkd2 UTSW 7 16853344 missense probably benign 0.01
R7983:Prkd2 UTSW 7 16853344 missense probably benign 0.01
X0062:Prkd2 UTSW 7 16855791 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTTTGCTCAGTGGGAAGCTG -3'
(R):5'- GCCTCCCAAGTTCTCTTAGAG -3'

Sequencing Primer
(F):5'- CTCAGTGGGAAGCTGGTGTG -3'
(R):5'- AGAGCTTCTGTCACTTACTTCTAAG -3'
Posted On2018-04-27