Incidental Mutation 'R6361:Cep89'
ID513116
Institutional Source Beutler Lab
Gene Symbol Cep89
Ensembl Gene ENSMUSG00000023072
Gene Namecentrosomal protein 89
SynonymsCcdc123, 2610507L03Rik
MMRRC Submission
Accession Numbers

Genbank: NM_028120; MGI: 1919390

Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R6361 (G1)
Quality Score124.008
Status Not validated
Chromosome7
Chromosomal Location35397035-35438689 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 35398047 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 33 (P33S)
Ref Sequence ENSEMBL: ENSMUSP00000078383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032704] [ENSMUST00000079414] [ENSMUST00000141704] [ENSMUST00000154597] [ENSMUST00000206854]
Predicted Effect probably benign
Transcript: ENSMUST00000032704
SMART Domains Protein: ENSMUSP00000032704
Gene: ENSMUSG00000030493

DomainStartEndE-ValueType
Pfam:HHH_2 162 219 1.3e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000079414
AA Change: P33S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078383
Gene: ENSMUSG00000023072
AA Change: P33S

DomainStartEndE-ValueType
low complexity region 27 62 N/A INTRINSIC
low complexity region 181 190 N/A INTRINSIC
coiled coil region 252 291 N/A INTRINSIC
coiled coil region 372 598 N/A INTRINSIC
coiled coil region 670 732 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125041
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129064
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141001
Predicted Effect probably damaging
Transcript: ENSMUST00000141704
AA Change: P33S

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000121393
Gene: ENSMUSG00000023072
AA Change: P33S

DomainStartEndE-ValueType
low complexity region 27 62 N/A INTRINSIC
low complexity region 181 190 N/A INTRINSIC
coiled coil region 252 291 N/A INTRINSIC
coiled coil region 372 598 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154597
SMART Domains Protein: ENSMUSP00000115766
Gene: ENSMUSG00000030493

DomainStartEndE-ValueType
Pfam:HHH_2 162 219 2.3e-13 PFAM
Predicted Effect silent
Transcript: ENSMUST00000206854
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency 98% (43/44)
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A T 4: 42,972,695 D676V probably benign Het
6430531B16Rik T A 7: 139,976,672 D134V possibly damaging Het
Asap1 C T 15: 64,349,823 probably null Het
Cabin1 G A 10: 75,726,865 A29V possibly damaging Het
Cadps G A 14: 12,491,778 Q791* probably null Het
Cdc14b T C 13: 64,216,209 probably null Het
Clec18a A G 8: 111,081,029 probably benign Het
Cln5 T A 14: 103,076,201 D296E probably benign Het
Col6a4 A T 9: 106,066,703 S1191T probably benign Het
Crispld1 A G 1: 17,762,231 I480M probably damaging Het
Dhrs7 A C 12: 72,664,659 L32V probably damaging Het
Dscam T C 16: 96,622,811 T1645A probably benign Het
Eif2b3 A G 4: 117,028,425 T55A possibly damaging Het
Ercc6 T C 14: 32,517,110 Y52H probably benign Het
Fam170b C A 14: 32,836,071 Q288K unknown Het
Flt4 A G 11: 49,630,578 T442A probably benign Het
Gm19402 A T 10: 77,690,061 probably benign Het
Gm4841 A G 18: 60,270,760 I87T probably damaging Het
Hspb7 A G 4: 141,422,549 E82G possibly damaging Het
Itgb3 A G 11: 104,665,582 K750E possibly damaging Het
Itsn2 A G 12: 4,629,655 M155V probably benign Het
March8 A T 6: 116,402,101 D332V probably null Het
Mst1r A G 9: 107,915,853 M1042V probably benign Het
Muc4 T C 16: 32,767,351 F2756L probably benign Het
Myl6b T A 10: 128,497,209 K55* probably null Het
Olfr1230 A T 2: 89,296,646 I208N probably damaging Het
Olfr1301 G T 2: 111,754,595 L115F probably damaging Het
Olfr150 A C 9: 39,737,672 N286H probably damaging Het
Olfr348 A G 2: 36,786,780 N85S probably damaging Het
Olfr830 T C 9: 18,875,731 Y132H probably damaging Het
Pcca A G 14: 122,638,382 D141G probably benign Het
Pkd2 C T 5: 104,486,680 R526* probably null Het
Polr2a C A 11: 69,743,337 A756S probably damaging Het
Prkd2 T C 7: 16,847,654 S145P probably damaging Het
Rhbdf1 T C 11: 32,212,915 N451D possibly damaging Het
Rundc3a G A 11: 102,400,795 R358Q probably damaging Het
Tbc1d4 T C 14: 101,507,174 K339E probably damaging Het
Usp37 A G 1: 74,453,893 I723T probably benign Het
Vwa2 A T 19: 56,901,526 probably null Het
Zdbf2 A C 1: 63,303,321 R286S possibly damaging Het
Zfp422 G A 6: 116,626,820 H73Y probably damaging Het
Zfp868 T C 8: 69,611,913 H257R probably damaging Het
Zzef1 A G 11: 72,884,349 S1723G possibly damaging Het
Other mutations in Cep89
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00784:Cep89 APN 7 35405707 missense possibly damaging 0.92
IGL01546:Cep89 APN 7 35420900 missense probably damaging 1.00
IGL02001:Cep89 APN 7 35403007 splice site probably benign
IGL02141:Cep89 APN 7 35420924 missense probably damaging 1.00
IGL02468:Cep89 APN 7 35403152 missense probably benign 0.35
IGL02507:Cep89 APN 7 35435565 missense probably damaging 1.00
IGL02612:Cep89 APN 7 35424655 critical splice acceptor site probably null
IGL03324:Cep89 APN 7 35424653 intron probably benign
IGL03396:Cep89 APN 7 35429178 missense probably benign 0.05
3-1:Cep89 UTSW 7 35424722 missense probably damaging 0.99
FR4304:Cep89 UTSW 7 35409641 utr 3 prime probably benign
FR4976:Cep89 UTSW 7 35409641 utr 3 prime probably benign
K2124:Cep89 UTSW 7 35420972 splice site probably benign
R0127:Cep89 UTSW 7 35428262 missense possibly damaging 0.92
R0416:Cep89 UTSW 7 35416402 unclassified probably benign
R0609:Cep89 UTSW 7 35435530 missense probably damaging 1.00
R1442:Cep89 UTSW 7 35418211 splice site probably benign
R1468:Cep89 UTSW 7 35420963 splice site probably null
R1468:Cep89 UTSW 7 35420963 splice site probably null
R1661:Cep89 UTSW 7 35417680 missense possibly damaging 0.66
R3981:Cep89 UTSW 7 35438383 missense probably damaging 1.00
R4414:Cep89 UTSW 7 35416397 unclassified probably benign
R4700:Cep89 UTSW 7 35438437 missense probably benign 0.05
R4963:Cep89 UTSW 7 35403152 missense probably benign 0.35
R4968:Cep89 UTSW 7 35409630 missense possibly damaging 0.90
R4972:Cep89 UTSW 7 35432552 missense probably damaging 1.00
R5578:Cep89 UTSW 7 35409642 unclassified probably benign
R5767:Cep89 UTSW 7 35417645 missense probably damaging 1.00
R5809:Cep89 UTSW 7 35417726 missense probably damaging 0.97
R5890:Cep89 UTSW 7 35429162 missense probably damaging 0.99
R6290:Cep89 UTSW 7 35420263 missense probably damaging 1.00
R6627:Cep89 UTSW 7 35427747 missense possibly damaging 0.90
R7272:Cep89 UTSW 7 35438463 missense probably benign 0.03
R7340:Cep89 UTSW 7 35429928 missense probably damaging 0.97
R7341:Cep89 UTSW 7 35429928 missense probably damaging 0.97
R7347:Cep89 UTSW 7 35429928 missense probably damaging 0.97
R7348:Cep89 UTSW 7 35429928 missense probably damaging 0.97
R7365:Cep89 UTSW 7 35429928 missense probably damaging 0.97
R7366:Cep89 UTSW 7 35429928 missense probably damaging 0.97
R7394:Cep89 UTSW 7 35429928 missense probably damaging 0.97
R7399:Cep89 UTSW 7 35438378 missense probably damaging 1.00
R7422:Cep89 UTSW 7 35428247 missense probably damaging 1.00
R7792:Cep89 UTSW 7 35429928 missense probably damaging 0.97
R7793:Cep89 UTSW 7 35429928 missense probably damaging 0.97
R7819:Cep89 UTSW 7 35432543 missense probably benign 0.07
R7860:Cep89 UTSW 7 35414145 missense possibly damaging 0.63
R7899:Cep89 UTSW 7 35429928 missense probably damaging 0.97
V7732:Cep89 UTSW 7 35403098 missense probably damaging 1.00
Z1177:Cep89 UTSW 7 35397081 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGTAAAGACTCTTGTGGGGCC -3'
(R):5'- AGACAAGTCCACTGATGCTC -3'

Sequencing Primer
(F):5'- CGGATCCCTAGAGTGACCTCAG -3'
(R):5'- GCCATATTAGTGCATCTCTGAGCAG -3'
Posted On2018-04-27