Incidental Mutation 'R6361:6430531B16Rik'
ID513117
Institutional Source Beutler Lab
Gene Symbol 6430531B16Rik
Ensembl Gene ENSMUSG00000073795
Gene NameRIKEN cDNA 6430531B16 gene
SynonymsLOC381933
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R6361 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location139972303-139978755 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 139976672 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 134 (D134V)
Ref Sequence ENSEMBL: ENSMUSP00000147330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026546] [ENSMUST00000097970] [ENSMUST00000106069] [ENSMUST00000121412] [ENSMUST00000209335] [ENSMUST00000210254]
Predicted Effect probably benign
Transcript: ENSMUST00000026546
SMART Domains Protein: ENSMUSP00000026546
Gene: ENSMUSG00000025473

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Pep_M12B_propep 26 151 5.9e-35 PFAM
Pfam:Reprolysin_5 193 371 1e-22 PFAM
Pfam:Reprolysin_4 193 384 1.7e-16 PFAM
Pfam:Reprolysin 195 394 2.7e-70 PFAM
Pfam:Reprolysin_2 214 384 1.6e-16 PFAM
Pfam:Reprolysin_3 218 339 4.9e-21 PFAM
DISIN 411 486 5.16e-36 SMART
ACR 487 606 2.15e-35 SMART
EGF 613 642 3.06e-1 SMART
transmembrane domain 660 682 N/A INTRINSIC
low complexity region 732 762 N/A INTRINSIC
low complexity region 770 783 N/A INTRINSIC
low complexity region 784 812 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000097970
AA Change: D134V

PolyPhen 2 Score 0.548 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000095584
Gene: ENSMUSG00000073795
AA Change: D134V

DomainStartEndE-ValueType
Pfam:CH_2 22 118 3e-35 PFAM
Pfam:CAMSAP_CH 23 105 1.2e-21 PFAM
coiled coil region 237 276 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106069
SMART Domains Protein: ENSMUSP00000101684
Gene: ENSMUSG00000025473

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Pep_M12B_propep 28 152 4e-30 PFAM
Pfam:Reprolysin_5 194 372 9.6e-23 PFAM
Pfam:Reprolysin_4 194 385 1.6e-16 PFAM
Pfam:Reprolysin 196 395 2.2e-73 PFAM
Pfam:Reprolysin_2 215 385 2.9e-18 PFAM
Pfam:Reprolysin_3 219 340 6.6e-21 PFAM
DISIN 412 487 5.16e-36 SMART
ACR 488 607 2.15e-35 SMART
EGF 614 643 3.06e-1 SMART
transmembrane domain 661 683 N/A INTRINSIC
low complexity region 733 763 N/A INTRINSIC
low complexity region 771 784 N/A INTRINSIC
low complexity region 785 813 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121412
AA Change: D134V

PolyPhen 2 Score 0.548 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113338
Gene: ENSMUSG00000073795
AA Change: D134V

DomainStartEndE-ValueType
Pfam:DUF1042 22 153 4.5e-35 PFAM
Pfam:CAMSAP_CH 23 105 1.3e-20 PFAM
low complexity region 230 246 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128332
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132903
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139218
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146974
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156647
Predicted Effect possibly damaging
Transcript: ENSMUST00000209335
AA Change: D134V

PolyPhen 2 Score 0.548 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000210254
AA Change: D134V

PolyPhen 2 Score 0.548 (Sensitivity: 0.88; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A T 4: 42,972,695 D676V probably benign Het
Asap1 C T 15: 64,349,823 probably null Het
Cabin1 G A 10: 75,726,865 A29V possibly damaging Het
Cadps G A 14: 12,491,778 Q791* probably null Het
Cdc14b T C 13: 64,216,209 probably null Het
Cep89 C T 7: 35,398,047 P33S probably damaging Het
Clec18a A G 8: 111,081,029 probably benign Het
Cln5 T A 14: 103,076,201 D296E probably benign Het
Col6a4 A T 9: 106,066,703 S1191T probably benign Het
Crispld1 A G 1: 17,762,231 I480M probably damaging Het
Dhrs7 A C 12: 72,664,659 L32V probably damaging Het
Dscam T C 16: 96,622,811 T1645A probably benign Het
Eif2b3 A G 4: 117,028,425 T55A possibly damaging Het
Ercc6 T C 14: 32,517,110 Y52H probably benign Het
Fam170b C A 14: 32,836,071 Q288K unknown Het
Flt4 A G 11: 49,630,578 T442A probably benign Het
Gm19402 A T 10: 77,690,061 probably benign Het
Gm4841 A G 18: 60,270,760 I87T probably damaging Het
Hspb7 A G 4: 141,422,549 E82G possibly damaging Het
Itgb3 A G 11: 104,665,582 K750E possibly damaging Het
Itsn2 A G 12: 4,629,655 M155V probably benign Het
March8 A T 6: 116,402,101 D332V probably null Het
Mst1r A G 9: 107,915,853 M1042V probably benign Het
Muc4 T C 16: 32,767,351 F2756L probably benign Het
Myl6b T A 10: 128,497,209 K55* probably null Het
Olfr1230 A T 2: 89,296,646 I208N probably damaging Het
Olfr1301 G T 2: 111,754,595 L115F probably damaging Het
Olfr150 A C 9: 39,737,672 N286H probably damaging Het
Olfr348 A G 2: 36,786,780 N85S probably damaging Het
Olfr830 T C 9: 18,875,731 Y132H probably damaging Het
Pcca A G 14: 122,638,382 D141G probably benign Het
Pkd2 C T 5: 104,486,680 R526* probably null Het
Polr2a C A 11: 69,743,337 A756S probably damaging Het
Prkd2 T C 7: 16,847,654 S145P probably damaging Het
Rhbdf1 T C 11: 32,212,915 N451D possibly damaging Het
Rundc3a G A 11: 102,400,795 R358Q probably damaging Het
Tbc1d4 T C 14: 101,507,174 K339E probably damaging Het
Usp37 A G 1: 74,453,893 I723T probably benign Het
Vwa2 A T 19: 56,901,526 probably null Het
Zdbf2 A C 1: 63,303,321 R286S possibly damaging Het
Zfp422 G A 6: 116,626,820 H73Y probably damaging Het
Zfp868 T C 8: 69,611,913 H257R probably damaging Het
Zzef1 A G 11: 72,884,349 S1723G possibly damaging Het
Other mutations in 6430531B16Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:6430531B16Rik APN 7 139978103 missense probably damaging 1.00
IGL01900:6430531B16Rik APN 7 139972570 missense probably damaging 1.00
IGL03395:6430531B16Rik APN 7 139976676 splice site probably benign
R0562:6430531B16Rik UTSW 7 139977113 missense probably benign 0.01
R1121:6430531B16Rik UTSW 7 139976630 missense probably benign 0.00
R1474:6430531B16Rik UTSW 7 139976642 missense probably benign
R1844:6430531B16Rik UTSW 7 139976092 missense probably benign 0.06
R2680:6430531B16Rik UTSW 7 139978561 missense probably damaging 1.00
R3113:6430531B16Rik UTSW 7 139975965 splice site probably benign
R4478:6430531B16Rik UTSW 7 139975860 critical splice donor site probably null
R4576:6430531B16Rik UTSW 7 139978130 missense probably damaging 1.00
R4577:6430531B16Rik UTSW 7 139978130 missense probably damaging 1.00
R5037:6430531B16Rik UTSW 7 139978674 missense possibly damaging 0.84
R5935:6430531B16Rik UTSW 7 139976613 missense probably benign 0.37
R6314:6430531B16Rik UTSW 7 139976489 missense possibly damaging 0.92
R7326:6430531B16Rik UTSW 7 139978545 critical splice donor site probably null
R7386:6430531B16Rik UTSW 7 139976052 nonsense probably null
R7658:6430531B16Rik UTSW 7 139976618 missense probably benign
R8300:6430531B16Rik UTSW 7 139977178 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGAGTTCAACATCATGGAC -3'
(R):5'- CTGCTGATCTTCTGGAAGGG -3'

Sequencing Primer
(F):5'- ACATCATGGACCCAGCTTTCGG -3'
(R):5'- GAATTTCCTTTCCAGCCAAATCCAC -3'
Posted On2018-04-27