Incidental Mutation 'R6361:Cabin1'
ID513123
Institutional Source Beutler Lab
Gene Symbol Cabin1
Ensembl Gene ENSMUSG00000020196
Gene Namecalcineurin binding protein 1
SynonymsCain, Ppp3in, A330070M20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6361 (G1)
Quality Score96.0077
Status Validated
Chromosome10
Chromosomal Location75646112-75764341 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 75726865 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 29 (A29V)
Ref Sequence ENSEMBL: ENSMUSP00000151436 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001712] [ENSMUST00000218790] [ENSMUST00000218878]
Predicted Effect probably benign
Transcript: ENSMUST00000001712
AA Change: A968V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000001712
Gene: ENSMUSG00000020196
AA Change: A968V

DomainStartEndE-ValueType
low complexity region 61 71 N/A INTRINSIC
TPR 90 123 4.15e-2 SMART
TPR 124 157 5.69e0 SMART
low complexity region 312 326 N/A INTRINSIC
low complexity region 365 381 N/A INTRINSIC
TPR 615 648 9.7e0 SMART
low complexity region 740 750 N/A INTRINSIC
low complexity region 882 892 N/A INTRINSIC
TPR 1055 1088 6.92e1 SMART
low complexity region 1327 1349 N/A INTRINSIC
low complexity region 1714 1727 N/A INTRINSIC
low complexity region 1778 1790 N/A INTRINSIC
low complexity region 1791 1803 N/A INTRINSIC
low complexity region 1810 1831 N/A INTRINSIC
low complexity region 1941 1956 N/A INTRINSIC
Pfam:MEF2_binding 2123 2157 5.7e-26 PFAM
low complexity region 2165 2183 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000217810
AA Change: A141V
Predicted Effect possibly damaging
Transcript: ENSMUST00000218790
AA Change: A29V

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000218878
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219682
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220009
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calcineurin plays an important role in the T-cell receptor-mediated signal transduction pathway. The protein encoded by this gene binds specifically to the activated form of calcineurin and inhibits calcineurin-mediated signal transduction. The encoded protein is found in the nucleus and contains a leucine zipper domain as well as several PEST motifs, sequences which confer targeted degradation to those proteins which contain them. Alternative splicing results in multiple transcript variants encoding two different isoforms. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous null mutants exhibit embryonic lethality during organogenesis. Mice producing a truncated protein exhibit elevated levels of serum IgG1, IgG2b and IgE, produce more IgG1 in response to T-cell dependent antigen, and have enhanced expression of cytokines in response to anti-CD3 stimulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A T 4: 42,972,695 D676V probably benign Het
6430531B16Rik T A 7: 139,976,672 D134V possibly damaging Het
Asap1 C T 15: 64,349,823 probably null Het
Cadps G A 14: 12,491,778 Q791* probably null Het
Cdc14b T C 13: 64,216,209 probably null Het
Cep89 C T 7: 35,398,047 P33S probably damaging Het
Clec18a A G 8: 111,081,029 probably benign Het
Cln5 T A 14: 103,076,201 D296E probably benign Het
Col6a4 A T 9: 106,066,703 S1191T probably benign Het
Crispld1 A G 1: 17,762,231 I480M probably damaging Het
Dhrs7 A C 12: 72,664,659 L32V probably damaging Het
Dscam T C 16: 96,622,811 T1645A probably benign Het
Eif2b3 A G 4: 117,028,425 T55A possibly damaging Het
Ercc6 T C 14: 32,517,110 Y52H probably benign Het
Fam170b C A 14: 32,836,071 Q288K unknown Het
Flt4 A G 11: 49,630,578 T442A probably benign Het
Gm19402 A T 10: 77,690,061 probably benign Het
Gm4841 A G 18: 60,270,760 I87T probably damaging Het
Hspb7 A G 4: 141,422,549 E82G possibly damaging Het
Itgb3 A G 11: 104,665,582 K750E possibly damaging Het
Itsn2 A G 12: 4,629,655 M155V probably benign Het
March8 A T 6: 116,402,101 D332V probably null Het
Mst1r A G 9: 107,915,853 M1042V probably benign Het
Muc4 T C 16: 32,767,351 F2756L probably benign Het
Myl6b T A 10: 128,497,209 K55* probably null Het
Olfr1230 A T 2: 89,296,646 I208N probably damaging Het
Olfr1301 G T 2: 111,754,595 L115F probably damaging Het
Olfr150 A C 9: 39,737,672 N286H probably damaging Het
Olfr348 A G 2: 36,786,780 N85S probably damaging Het
Olfr830 T C 9: 18,875,731 Y132H probably damaging Het
Pcca A G 14: 122,638,382 D141G probably benign Het
Pkd2 C T 5: 104,486,680 R526* probably null Het
Polr2a C A 11: 69,743,337 A756S probably damaging Het
Prkd2 T C 7: 16,847,654 S145P probably damaging Het
Rhbdf1 T C 11: 32,212,915 N451D possibly damaging Het
Rundc3a G A 11: 102,400,795 R358Q probably damaging Het
Tbc1d4 T C 14: 101,507,174 K339E probably damaging Het
Usp37 A G 1: 74,453,893 I723T probably benign Het
Vwa2 A T 19: 56,901,526 probably null Het
Zdbf2 A C 1: 63,303,321 R286S possibly damaging Het
Zfp422 G A 6: 116,626,820 H73Y probably damaging Het
Zfp868 T C 8: 69,611,913 H257R probably damaging Het
Zzef1 A G 11: 72,884,349 S1723G possibly damaging Het
Other mutations in Cabin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01434:Cabin1 APN 10 75725586 missense possibly damaging 0.58
IGL01457:Cabin1 APN 10 75742429 missense probably damaging 0.96
IGL02217:Cabin1 APN 10 75700047 missense possibly damaging 0.95
IGL02649:Cabin1 APN 10 75737418 missense probably damaging 1.00
IGL02737:Cabin1 APN 10 75713585 missense probably benign 0.09
IGL02792:Cabin1 APN 10 75746739 missense probably damaging 1.00
IGL03047:Cabin1 APN 10 75700100 splice site probably benign
IGL03106:Cabin1 APN 10 75733628 missense probably benign 0.01
IGL03276:Cabin1 APN 10 75732413 missense probably damaging 1.00
R0335:Cabin1 UTSW 10 75657049 missense probably damaging 1.00
R0557:Cabin1 UTSW 10 75726917 missense probably damaging 1.00
R0578:Cabin1 UTSW 10 75713610 missense probably damaging 0.96
R0588:Cabin1 UTSW 10 75745337 missense possibly damaging 0.71
R1115:Cabin1 UTSW 10 75717677 missense possibly damaging 0.70
R1120:Cabin1 UTSW 10 75725716 missense probably damaging 1.00
R1439:Cabin1 UTSW 10 75656806 missense probably damaging 1.00
R1471:Cabin1 UTSW 10 75694792 missense probably damaging 1.00
R1794:Cabin1 UTSW 10 75725745 missense possibly damaging 0.52
R1844:Cabin1 UTSW 10 75743350 splice site probably null
R1959:Cabin1 UTSW 10 75735090 missense possibly damaging 0.92
R2008:Cabin1 UTSW 10 75734976 unclassified probably null
R2279:Cabin1 UTSW 10 75753461 missense probably benign
R3150:Cabin1 UTSW 10 75656911 missense probably damaging 1.00
R3929:Cabin1 UTSW 10 75751618 critical splice acceptor site probably null
R3945:Cabin1 UTSW 10 75745259 missense probably damaging 1.00
R3946:Cabin1 UTSW 10 75745259 missense probably damaging 1.00
R4206:Cabin1 UTSW 10 75754841 missense possibly damaging 0.69
R4812:Cabin1 UTSW 10 75646594 missense possibly damaging 0.93
R4944:Cabin1 UTSW 10 75721363 missense probably damaging 1.00
R4944:Cabin1 UTSW 10 75739421 missense probably damaging 0.99
R5078:Cabin1 UTSW 10 75721478 missense probably damaging 1.00
R5082:Cabin1 UTSW 10 75738330 missense probably damaging 0.99
R5319:Cabin1 UTSW 10 75725715 missense probably damaging 1.00
R5481:Cabin1 UTSW 10 75735066 missense probably benign 0.29
R5504:Cabin1 UTSW 10 75653009 missense probably benign 0.00
R5710:Cabin1 UTSW 10 75647018 missense probably benign 0.00
R5908:Cabin1 UTSW 10 75721532 missense probably damaging 1.00
R5975:Cabin1 UTSW 10 75657839 missense probably damaging 1.00
R5982:Cabin1 UTSW 10 75725560 missense probably benign 0.00
R6038:Cabin1 UTSW 10 75739366 missense probably benign 0.02
R6038:Cabin1 UTSW 10 75739366 missense probably benign 0.02
R6114:Cabin1 UTSW 10 75747971 missense probably benign 0.00
R6285:Cabin1 UTSW 10 75684323 missense probably damaging 1.00
R6341:Cabin1 UTSW 10 75658739 missense probably damaging 0.98
R6395:Cabin1 UTSW 10 75746742 missense probably benign 0.10
R6422:Cabin1 UTSW 10 75656792 missense probably damaging 1.00
R6575:Cabin1 UTSW 10 75725701 missense possibly damaging 0.90
R6763:Cabin1 UTSW 10 75746730 missense probably damaging 0.99
R6845:Cabin1 UTSW 10 75721508 missense probably damaging 1.00
R6936:Cabin1 UTSW 10 75715758 splice site probably null
R7050:Cabin1 UTSW 10 75713542 missense probably damaging 1.00
R7055:Cabin1 UTSW 10 75743283 missense probably benign 0.04
R7101:Cabin1 UTSW 10 75751567 missense probably benign
R7138:Cabin1 UTSW 10 75745353 missense probably damaging 0.98
R7173:Cabin1 UTSW 10 75746562 missense probably benign 0.00
R7265:Cabin1 UTSW 10 75721423 missense
R7284:Cabin1 UTSW 10 75694834 missense
R7472:Cabin1 UTSW 10 75658647 missense probably damaging 1.00
R7571:Cabin1 UTSW 10 75646666 missense probably damaging 1.00
R7617:Cabin1 UTSW 10 75732443 missense possibly damaging 0.85
R7739:Cabin1 UTSW 10 75658658 missense probably damaging 1.00
R7997:Cabin1 UTSW 10 75733775 missense probably benign 0.01
Z1177:Cabin1 UTSW 10 75648123 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AACTGCAAATAAGCCTGTGAAC -3'
(R):5'- TTCCACTGTCACAGGTGCAAG -3'

Sequencing Primer
(F):5'- GAACAATTGTCATGCCATGCTGC -3'
(R):5'- GTTCTCCAAAAGGAGCTTGC -3'
Posted On2018-04-27