Incidental Mutation 'R6361:Gm19402'
ID513124
Institutional Source Beutler Lab
Gene Symbol Gm19402
Ensembl Gene ENSMUSG00000095970
Gene Namepredicted gene, 19402
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R6361 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location77689957-77690757 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 77690061 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000090020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092366] [ENSMUST00000180297]
Predicted Effect probably benign
Transcript: ENSMUST00000092366
SMART Domains Protein: ENSMUSP00000090020
Gene: ENSMUSG00000069581

DomainStartEndE-ValueType
Blast:TSPN 1 71 8e-40 BLAST
SCOP:d1c4ra_ 2 67 2e-7 SMART
low complexity region 190 200 N/A INTRINSIC
Pfam:EPTP 208 255 2.6e-22 PFAM
Pfam:EPTP 260 307 1.4e-21 PFAM
Pfam:EPTP 312 359 8.9e-14 PFAM
Pfam:EPTP 362 417 6.2e-13 PFAM
Pfam:EPTP 422 469 1.3e-20 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000180297
AA Change: S233T
SMART Domains Protein: ENSMUSP00000136066
Gene: ENSMUSG00000095970
AA Change: S233T

DomainStartEndE-ValueType
Pfam:Keratin_B2_2 25 71 2.1e-6 PFAM
Pfam:Keratin_B2_2 67 112 8.1e-9 PFAM
Pfam:Keratin_B2_2 108 157 1.4e-5 PFAM
Pfam:Keratin_B2_2 152 193 3.1e-7 PFAM
Pfam:Keratin_B2_2 189 234 3.4e-5 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A T 4: 42,972,695 D676V probably benign Het
6430531B16Rik T A 7: 139,976,672 D134V possibly damaging Het
Asap1 C T 15: 64,349,823 probably null Het
Cabin1 G A 10: 75,726,865 A29V possibly damaging Het
Cadps G A 14: 12,491,778 Q791* probably null Het
Cdc14b T C 13: 64,216,209 probably null Het
Cep89 C T 7: 35,398,047 P33S probably damaging Het
Clec18a A G 8: 111,081,029 probably benign Het
Cln5 T A 14: 103,076,201 D296E probably benign Het
Col6a4 A T 9: 106,066,703 S1191T probably benign Het
Crispld1 A G 1: 17,762,231 I480M probably damaging Het
Dhrs7 A C 12: 72,664,659 L32V probably damaging Het
Dscam T C 16: 96,622,811 T1645A probably benign Het
Eif2b3 A G 4: 117,028,425 T55A possibly damaging Het
Ercc6 T C 14: 32,517,110 Y52H probably benign Het
Fam170b C A 14: 32,836,071 Q288K unknown Het
Flt4 A G 11: 49,630,578 T442A probably benign Het
Gm4841 A G 18: 60,270,760 I87T probably damaging Het
Hspb7 A G 4: 141,422,549 E82G possibly damaging Het
Itgb3 A G 11: 104,665,582 K750E possibly damaging Het
Itsn2 A G 12: 4,629,655 M155V probably benign Het
March8 A T 6: 116,402,101 D332V probably null Het
Mst1r A G 9: 107,915,853 M1042V probably benign Het
Muc4 T C 16: 32,767,351 F2756L probably benign Het
Myl6b T A 10: 128,497,209 K55* probably null Het
Olfr1230 A T 2: 89,296,646 I208N probably damaging Het
Olfr1301 G T 2: 111,754,595 L115F probably damaging Het
Olfr150 A C 9: 39,737,672 N286H probably damaging Het
Olfr348 A G 2: 36,786,780 N85S probably damaging Het
Olfr830 T C 9: 18,875,731 Y132H probably damaging Het
Pcca A G 14: 122,638,382 D141G probably benign Het
Pkd2 C T 5: 104,486,680 R526* probably null Het
Polr2a C A 11: 69,743,337 A756S probably damaging Het
Prkd2 T C 7: 16,847,654 S145P probably damaging Het
Rhbdf1 T C 11: 32,212,915 N451D possibly damaging Het
Rundc3a G A 11: 102,400,795 R358Q probably damaging Het
Tbc1d4 T C 14: 101,507,174 K339E probably damaging Het
Usp37 A G 1: 74,453,893 I723T probably benign Het
Vwa2 A T 19: 56,901,526 probably null Het
Zdbf2 A C 1: 63,303,321 R286S possibly damaging Het
Zfp422 G A 6: 116,626,820 H73Y probably damaging Het
Zfp868 T C 8: 69,611,913 H257R probably damaging Het
Zzef1 A G 11: 72,884,349 S1723G possibly damaging Het
Other mutations in Gm19402
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Gm19402 APN 10 77690489 intron probably benign
R2471:Gm19402 UTSW 10 77690520 intron probably benign
R5743:Gm19402 UTSW 10 77690682 missense probably damaging 1.00
R6125:Gm19402 UTSW 10 77690673 missense probably damaging 0.99
R6285:Gm19402 UTSW 10 77690520 intron probably benign
R7372:Gm19402 UTSW 10 77690427 missense unknown
Predicted Primers PCR Primer
(F):5'- CTATGCTGGTGCCAAAATGG -3'
(R):5'- GCCAGTCCTCATGCTGTCAATC -3'

Sequencing Primer
(F):5'- GGATACATCCCTTGCAGGTCAC -3'
(R):5'- GTCAATCCCCCTGCTGTGTG -3'
Posted On2018-04-27