Incidental Mutation 'R6361:Rhbdf1'
ID513126
Institutional Source Beutler Lab
Gene Symbol Rhbdf1
Ensembl Gene ENSMUSG00000020282
Gene Namerhomboid 5 homolog 1
SynonymsDist, Dist1, Egfr-rs
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.293) question?
Stock #R6361 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location32209585-32222300 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32212915 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 451 (N451D)
Ref Sequence ENSEMBL: ENSMUSP00000020524 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020524] [ENSMUST00000039601] [ENSMUST00000121182] [ENSMUST00000132578] [ENSMUST00000143988] [ENSMUST00000144902] [ENSMUST00000146179] [ENSMUST00000149043] [ENSMUST00000150381]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020524
AA Change: N451D

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000020524
Gene: ENSMUSG00000020282
AA Change: N451D

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
Pfam:Rhomboid_SP 91 308 1.6e-116 PFAM
Pfam:Rhomboid 648 792 2.1e-32 PFAM
transmembrane domain 805 827 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000039601
SMART Domains Protein: ENSMUSP00000046654
Gene: ENSMUSG00000040767

DomainStartEndE-ValueType
PDB:1V2Y|A 31 123 4e-63 PDB
Blast:UBQ 32 119 1e-30 BLAST
SCOP:d1euvb_ 32 121 3e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121182
SMART Domains Protein: ENSMUSP00000112483
Gene: ENSMUSG00000040767

DomainStartEndE-ValueType
PDB:1V2Y|A 31 83 4e-28 PDB
Blast:UBQ 32 83 2e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125837
Predicted Effect probably benign
Transcript: ENSMUST00000132578
SMART Domains Protein: ENSMUSP00000120543
Gene: ENSMUSG00000020282

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
Pfam:Rhomboid_SP 91 158 7.9e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142274
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143036
Predicted Effect probably benign
Transcript: ENSMUST00000143988
SMART Domains Protein: ENSMUSP00000117471
Gene: ENSMUSG00000020282

DomainStartEndE-ValueType
Pfam:Rhomboid 52 167 1.6e-24 PFAM
transmembrane domain 181 203 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144902
SMART Domains Protein: ENSMUSP00000122533
Gene: ENSMUSG00000020282

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146179
SMART Domains Protein: ENSMUSP00000118985
Gene: ENSMUSG00000020282

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
Pfam:Rhomboid_SP 91 155 7.1e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149043
SMART Domains Protein: ENSMUSP00000119306
Gene: ENSMUSG00000040767

DomainStartEndE-ValueType
PDB:1V2Y|A 31 96 1e-40 PDB
Blast:UBQ 32 96 3e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000150381
SMART Domains Protein: ENSMUSP00000118769
Gene: ENSMUSG00000020282

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency 98% (43/44)
MGI Phenotype PHENOTYPE: Homozygotes for a null allele show pleiotropic phenotypes and postnatal lethality largely dependent on the genetic background. Observed defects range from small size, reduced fat mass, and brain haemorrhages to small lymph organs, thrombosis, abnormal pancreatic acini, and behavioral deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A T 4: 42,972,695 D676V probably benign Het
6430531B16Rik T A 7: 139,976,672 D134V possibly damaging Het
Asap1 C T 15: 64,349,823 probably null Het
Cabin1 G A 10: 75,726,865 A29V possibly damaging Het
Cadps G A 14: 12,491,778 Q791* probably null Het
Cdc14b T C 13: 64,216,209 probably null Het
Cep89 C T 7: 35,398,047 P33S probably damaging Het
Clec18a A G 8: 111,081,029 probably benign Het
Cln5 T A 14: 103,076,201 D296E probably benign Het
Col6a4 A T 9: 106,066,703 S1191T probably benign Het
Crispld1 A G 1: 17,762,231 I480M probably damaging Het
Dhrs7 A C 12: 72,664,659 L32V probably damaging Het
Dscam T C 16: 96,622,811 T1645A probably benign Het
Eif2b3 A G 4: 117,028,425 T55A possibly damaging Het
Ercc6 T C 14: 32,517,110 Y52H probably benign Het
Fam170b C A 14: 32,836,071 Q288K unknown Het
Flt4 A G 11: 49,630,578 T442A probably benign Het
Gm19402 A T 10: 77,690,061 probably benign Het
Gm4841 A G 18: 60,270,760 I87T probably damaging Het
Hspb7 A G 4: 141,422,549 E82G possibly damaging Het
Itgb3 A G 11: 104,665,582 K750E possibly damaging Het
Itsn2 A G 12: 4,629,655 M155V probably benign Het
March8 A T 6: 116,402,101 D332V probably null Het
Mst1r A G 9: 107,915,853 M1042V probably benign Het
Muc4 T C 16: 32,767,351 F2756L probably benign Het
Myl6b T A 10: 128,497,209 K55* probably null Het
Olfr1230 A T 2: 89,296,646 I208N probably damaging Het
Olfr1301 G T 2: 111,754,595 L115F probably damaging Het
Olfr150 A C 9: 39,737,672 N286H probably damaging Het
Olfr348 A G 2: 36,786,780 N85S probably damaging Het
Olfr830 T C 9: 18,875,731 Y132H probably damaging Het
Pcca A G 14: 122,638,382 D141G probably benign Het
Pkd2 C T 5: 104,486,680 R526* probably null Het
Polr2a C A 11: 69,743,337 A756S probably damaging Het
Prkd2 T C 7: 16,847,654 S145P probably damaging Het
Rundc3a G A 11: 102,400,795 R358Q probably damaging Het
Tbc1d4 T C 14: 101,507,174 K339E probably damaging Het
Usp37 A G 1: 74,453,893 I723T probably benign Het
Vwa2 A T 19: 56,901,526 probably null Het
Zdbf2 A C 1: 63,303,321 R286S possibly damaging Het
Zfp422 G A 6: 116,626,820 H73Y probably damaging Het
Zfp868 T C 8: 69,611,913 H257R probably damaging Het
Zzef1 A G 11: 72,884,349 S1723G possibly damaging Het
Other mutations in Rhbdf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01863:Rhbdf1 APN 11 32213484 missense probably benign
IGL02183:Rhbdf1 APN 11 32210543 missense probably damaging 1.00
IGL02793:Rhbdf1 APN 11 32213293 missense possibly damaging 0.92
IGL02875:Rhbdf1 APN 11 32213293 missense possibly damaging 0.92
FR4589:Rhbdf1 UTSW 11 32214391 unclassified probably benign
R0071:Rhbdf1 UTSW 11 32210498 missense probably damaging 1.00
R0180:Rhbdf1 UTSW 11 32210042 missense possibly damaging 0.76
R0512:Rhbdf1 UTSW 11 32210875 nonsense probably null
R0843:Rhbdf1 UTSW 11 32215053 missense probably damaging 1.00
R0880:Rhbdf1 UTSW 11 32213432 unclassified probably null
R1952:Rhbdf1 UTSW 11 32214277 nonsense probably null
R2017:Rhbdf1 UTSW 11 32210471 missense probably damaging 1.00
R2076:Rhbdf1 UTSW 11 32214088 missense probably benign 0.01
R3032:Rhbdf1 UTSW 11 32209985 missense probably damaging 1.00
R4355:Rhbdf1 UTSW 11 32216236 missense probably damaging 1.00
R4429:Rhbdf1 UTSW 11 32213369 missense probably benign 0.00
R4865:Rhbdf1 UTSW 11 32214517 missense probably damaging 1.00
R5585:Rhbdf1 UTSW 11 32210222 unclassified probably null
R5728:Rhbdf1 UTSW 11 32209901 unclassified probably null
R5925:Rhbdf1 UTSW 11 32212906 missense probably benign 0.24
R5940:Rhbdf1 UTSW 11 32209847 missense probably benign 0.00
R6083:Rhbdf1 UTSW 11 32210066 missense probably damaging 1.00
R6088:Rhbdf1 UTSW 11 32212007 missense possibly damaging 0.62
R6692:Rhbdf1 UTSW 11 32215652 missense probably damaging 0.98
R6727:Rhbdf1 UTSW 11 32214042 missense possibly damaging 0.78
R6825:Rhbdf1 UTSW 11 32209970 missense probably damaging 1.00
R7589:Rhbdf1 UTSW 11 32212903 missense probably benign 0.01
V3553:Rhbdf1 UTSW 11 32211583 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGATGAAGCTGTGCACCTG -3'
(R):5'- CTGTGTGCATCTATGGCATAGC -3'

Sequencing Primer
(F):5'- AAGCTGTGCACCTGTGGGTC -3'
(R):5'- AACTTGGAGTCTAGGCTG -3'
Posted On2018-04-27