Incidental Mutation 'R6361:Zzef1'
ID513129
Institutional Source Beutler Lab
Gene Symbol Zzef1
Ensembl Gene ENSMUSG00000055670
Gene Namezinc finger, ZZ-type with EF hand domain 1
SynonymsC130099L13Rik, 8430405D05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6361 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location72796226-72927120 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 72884349 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 1723 (S1723G)
Ref Sequence ENSEMBL: ENSMUSP00000147028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069395] [ENSMUST00000172220] [ENSMUST00000207107]
Predicted Effect possibly damaging
Transcript: ENSMUST00000069395
AA Change: S1723G

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000068790
Gene: ENSMUSG00000055670
AA Change: S1723G

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
low complexity region 28 68 N/A INTRINSIC
low complexity region 78 93 N/A INTRINSIC
APC10 246 397 2.65e-48 SMART
internal_repeat_1 1122 1192 1.25e-7 PROSPERO
low complexity region 1472 1485 N/A INTRINSIC
low complexity region 1512 1525 N/A INTRINSIC
ZnF_ZZ 1775 1823 2.54e-7 SMART
ZnF_ZZ 1824 1868 1.2e-8 SMART
low complexity region 1947 1963 N/A INTRINSIC
low complexity region 2127 2140 N/A INTRINSIC
low complexity region 2249 2263 N/A INTRINSIC
internal_repeat_1 2657 2726 1.25e-7 PROSPERO
low complexity region 2840 2853 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083364
Predicted Effect possibly damaging
Transcript: ENSMUST00000172220
AA Change: S1723G

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000130515
Gene: ENSMUSG00000055670
AA Change: S1723G

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
low complexity region 28 68 N/A INTRINSIC
low complexity region 78 93 N/A INTRINSIC
APC10 246 397 2.65e-48 SMART
internal_repeat_1 1006 1192 1.57e-16 PROSPERO
low complexity region 1472 1485 N/A INTRINSIC
low complexity region 1512 1525 N/A INTRINSIC
ZnF_ZZ 1775 1823 2.54e-7 SMART
ZnF_ZZ 1824 1868 1.2e-8 SMART
low complexity region 1947 1963 N/A INTRINSIC
low complexity region 2127 2140 N/A INTRINSIC
low complexity region 2249 2263 N/A INTRINSIC
internal_repeat_1 2583 2759 1.57e-16 PROSPERO
low complexity region 2873 2886 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000207107
AA Change: S1723G

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A T 4: 42,972,695 D676V probably benign Het
6430531B16Rik T A 7: 139,976,672 D134V possibly damaging Het
Asap1 C T 15: 64,349,823 probably null Het
Cabin1 G A 10: 75,726,865 A29V possibly damaging Het
Cadps G A 14: 12,491,778 Q791* probably null Het
Cdc14b T C 13: 64,216,209 probably null Het
Cep89 C T 7: 35,398,047 P33S probably damaging Het
Clec18a A G 8: 111,081,029 probably benign Het
Cln5 T A 14: 103,076,201 D296E probably benign Het
Col6a4 A T 9: 106,066,703 S1191T probably benign Het
Crispld1 A G 1: 17,762,231 I480M probably damaging Het
Dhrs7 A C 12: 72,664,659 L32V probably damaging Het
Dscam T C 16: 96,622,811 T1645A probably benign Het
Eif2b3 A G 4: 117,028,425 T55A possibly damaging Het
Ercc6 T C 14: 32,517,110 Y52H probably benign Het
Fam170b C A 14: 32,836,071 Q288K unknown Het
Flt4 A G 11: 49,630,578 T442A probably benign Het
Gm19402 A T 10: 77,690,061 probably benign Het
Gm4841 A G 18: 60,270,760 I87T probably damaging Het
Hspb7 A G 4: 141,422,549 E82G possibly damaging Het
Itgb3 A G 11: 104,665,582 K750E possibly damaging Het
Itsn2 A G 12: 4,629,655 M155V probably benign Het
March8 A T 6: 116,402,101 D332V probably null Het
Mst1r A G 9: 107,915,853 M1042V probably benign Het
Muc4 T C 16: 32,767,351 F2756L probably benign Het
Myl6b T A 10: 128,497,209 K55* probably null Het
Olfr1230 A T 2: 89,296,646 I208N probably damaging Het
Olfr1301 G T 2: 111,754,595 L115F probably damaging Het
Olfr150 A C 9: 39,737,672 N286H probably damaging Het
Olfr348 A G 2: 36,786,780 N85S probably damaging Het
Olfr830 T C 9: 18,875,731 Y132H probably damaging Het
Pcca A G 14: 122,638,382 D141G probably benign Het
Pkd2 C T 5: 104,486,680 R526* probably null Het
Polr2a C A 11: 69,743,337 A756S probably damaging Het
Prkd2 T C 7: 16,847,654 S145P probably damaging Het
Rhbdf1 T C 11: 32,212,915 N451D possibly damaging Het
Rundc3a G A 11: 102,400,795 R358Q probably damaging Het
Tbc1d4 T C 14: 101,507,174 K339E probably damaging Het
Usp37 A G 1: 74,453,893 I723T probably benign Het
Vwa2 A T 19: 56,901,526 probably null Het
Zdbf2 A C 1: 63,303,321 R286S possibly damaging Het
Zfp422 G A 6: 116,626,820 H73Y probably damaging Het
Zfp868 T C 8: 69,611,913 H257R probably damaging Het
Other mutations in Zzef1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Zzef1 APN 11 72875126 missense probably benign 0.02
IGL00898:Zzef1 APN 11 72875173 missense probably benign 0.00
IGL00970:Zzef1 APN 11 72915245 missense probably benign 0.06
IGL01062:Zzef1 APN 11 72874969 missense probably benign
IGL01832:Zzef1 APN 11 72875066 missense probably damaging 0.99
IGL02005:Zzef1 APN 11 72888299 missense probably benign 0.00
IGL02026:Zzef1 APN 11 72881338 missense probably benign 0.39
IGL02110:Zzef1 APN 11 72913112 missense probably damaging 1.00
IGL02305:Zzef1 APN 11 72866597 splice site probably benign
IGL02308:Zzef1 APN 11 72886747 missense probably benign 0.04
IGL02315:Zzef1 APN 11 72875257 nonsense probably null
IGL02332:Zzef1 APN 11 72916509 missense probably benign 0.01
IGL02389:Zzef1 APN 11 72891217 missense probably benign
IGL02389:Zzef1 APN 11 72899538 missense possibly damaging 0.89
IGL02451:Zzef1 APN 11 72901388 missense probably damaging 0.99
IGL02541:Zzef1 APN 11 72872649 missense probably damaging 1.00
IGL02950:Zzef1 APN 11 72917699 splice site probably benign
IGL02953:Zzef1 APN 11 72855398 missense probably benign
IGL03053:Zzef1 APN 11 72831539 splice site probably benign
IGL03085:Zzef1 APN 11 72855524 splice site probably benign
IGL03152:Zzef1 APN 11 72923182 critical splice donor site probably null
IGL03329:Zzef1 APN 11 72917273 splice site probably benign
IGL03376:Zzef1 APN 11 72876551 splice site probably benign
IGL03394:Zzef1 APN 11 72886775 splice site probably null
Dreidel UTSW 11 72908469 nonsense probably null
Hanukkah UTSW 11 72893332 missense probably benign 0.00
Mezuzah UTSW 11 72848733 nonsense probably null
BB005:Zzef1 UTSW 11 72821896 missense probably damaging 0.99
BB015:Zzef1 UTSW 11 72821896 missense probably damaging 0.99
PIT4508001:Zzef1 UTSW 11 72895176 missense probably benign
PIT4581001:Zzef1 UTSW 11 72899672 missense probably benign 0.00
PIT4810001:Zzef1 UTSW 11 72850745 missense probably damaging 1.00
R0094:Zzef1 UTSW 11 72817965 missense probably benign 0.01
R0119:Zzef1 UTSW 11 72821851 missense probably benign
R0136:Zzef1 UTSW 11 72821851 missense probably benign
R0140:Zzef1 UTSW 11 72899551 missense possibly damaging 0.70
R0212:Zzef1 UTSW 11 72873910 missense possibly damaging 0.66
R0217:Zzef1 UTSW 11 72889068 missense probably damaging 1.00
R0220:Zzef1 UTSW 11 72865966 missense probably damaging 1.00
R0304:Zzef1 UTSW 11 72880624 missense probably benign 0.10
R0400:Zzef1 UTSW 11 72895242 missense probably damaging 1.00
R0422:Zzef1 UTSW 11 72866091 missense possibly damaging 0.93
R0471:Zzef1 UTSW 11 72923111 missense probably damaging 1.00
R0557:Zzef1 UTSW 11 72917730 missense probably damaging 1.00
R0581:Zzef1 UTSW 11 72851900 missense probably benign 0.00
R0599:Zzef1 UTSW 11 72913178 missense probably damaging 1.00
R0603:Zzef1 UTSW 11 72818069 missense probably benign 0.00
R0657:Zzef1 UTSW 11 72821851 missense probably benign
R0987:Zzef1 UTSW 11 72901333 small deletion probably benign
R1246:Zzef1 UTSW 11 72874909 missense probably benign 0.00
R1327:Zzef1 UTSW 11 72893414 critical splice donor site probably null
R1438:Zzef1 UTSW 11 72912945 missense probably damaging 0.96
R1466:Zzef1 UTSW 11 72924679 missense probably damaging 1.00
R1466:Zzef1 UTSW 11 72924679 missense probably damaging 1.00
R1485:Zzef1 UTSW 11 72900809 splice site probably null
R1556:Zzef1 UTSW 11 72915233 missense probably damaging 1.00
R1563:Zzef1 UTSW 11 72848733 nonsense probably null
R1584:Zzef1 UTSW 11 72924679 missense probably damaging 1.00
R1643:Zzef1 UTSW 11 72826202 missense probably damaging 1.00
R1646:Zzef1 UTSW 11 72864036 critical splice donor site probably null
R1764:Zzef1 UTSW 11 72893332 missense probably benign 0.00
R1777:Zzef1 UTSW 11 72910272 missense probably damaging 1.00
R1793:Zzef1 UTSW 11 72886709 missense probably damaging 1.00
R1900:Zzef1 UTSW 11 72848714 missense probably damaging 0.99
R2096:Zzef1 UTSW 11 72872639 missense probably benign 0.02
R2134:Zzef1 UTSW 11 72880624 missense probably benign 0.02
R2157:Zzef1 UTSW 11 72848634 splice site probably benign
R2183:Zzef1 UTSW 11 72886718 nonsense probably null
R2192:Zzef1 UTSW 11 72910156 splice site probably null
R2230:Zzef1 UTSW 11 72884416 missense probably damaging 0.99
R2259:Zzef1 UTSW 11 72900633 nonsense probably null
R2384:Zzef1 UTSW 11 72858394 missense probably damaging 0.99
R2426:Zzef1 UTSW 11 72915265 missense probably benign 0.01
R2915:Zzef1 UTSW 11 72910326 splice site probably null
R3700:Zzef1 UTSW 11 72886772 missense probably null 1.00
R3875:Zzef1 UTSW 11 72889040 missense probably benign 0.22
R3902:Zzef1 UTSW 11 72908500 missense probably damaging 1.00
R3927:Zzef1 UTSW 11 72858382 missense probably damaging 1.00
R4086:Zzef1 UTSW 11 72875053 missense probably benign 0.02
R4301:Zzef1 UTSW 11 72889035 missense probably damaging 0.96
R4359:Zzef1 UTSW 11 72823508 missense probably damaging 0.98
R4382:Zzef1 UTSW 11 72875112 missense probably benign 0.00
R4453:Zzef1 UTSW 11 72872639 missense probably benign 0.02
R4466:Zzef1 UTSW 11 72924659 missense probably damaging 1.00
R4471:Zzef1 UTSW 11 72913331 missense probably damaging 1.00
R4510:Zzef1 UTSW 11 72888170 missense probably benign 0.32
R4511:Zzef1 UTSW 11 72888170 missense probably benign 0.32
R4714:Zzef1 UTSW 11 72837212 missense probably damaging 1.00
R4799:Zzef1 UTSW 11 72859623 missense probably benign 0.12
R4906:Zzef1 UTSW 11 72901388 missense probably damaging 1.00
R5075:Zzef1 UTSW 11 72858344 missense probably damaging 1.00
R5357:Zzef1 UTSW 11 72843333 nonsense probably null
R5579:Zzef1 UTSW 11 72900637 missense probably damaging 0.98
R5598:Zzef1 UTSW 11 72916521 missense probably damaging 1.00
R5725:Zzef1 UTSW 11 72855482 missense possibly damaging 0.86
R5765:Zzef1 UTSW 11 72821937 nonsense probably null
R5928:Zzef1 UTSW 11 72912852 missense probably damaging 1.00
R6003:Zzef1 UTSW 11 72824065 splice site probably null
R6047:Zzef1 UTSW 11 72866095 missense probably damaging 0.99
R6224:Zzef1 UTSW 11 72855383 missense probably damaging 0.99
R6225:Zzef1 UTSW 11 72869805 missense possibly damaging 0.62
R6287:Zzef1 UTSW 11 72923112 missense probably damaging 1.00
R6451:Zzef1 UTSW 11 72923156 missense possibly damaging 0.88
R6467:Zzef1 UTSW 11 72911264 critical splice donor site probably null
R6484:Zzef1 UTSW 11 72895271 missense probably damaging 1.00
R6493:Zzef1 UTSW 11 72913303 missense probably benign 0.06
R6520:Zzef1 UTSW 11 72826065 missense probably damaging 1.00
R6527:Zzef1 UTSW 11 72874990 missense probably benign 0.00
R6540:Zzef1 UTSW 11 72913229 missense probably damaging 1.00
R6608:Zzef1 UTSW 11 72912826 missense probably damaging 1.00
R6795:Zzef1 UTSW 11 72850659 missense probably benign 0.00
R6927:Zzef1 UTSW 11 72913157 missense probably damaging 1.00
R6987:Zzef1 UTSW 11 72855514 missense possibly damaging 0.89
R7048:Zzef1 UTSW 11 72866699 nonsense probably null
R7076:Zzef1 UTSW 11 72899559 missense probably benign 0.00
R7099:Zzef1 UTSW 11 72872649 missense possibly damaging 0.92
R7132:Zzef1 UTSW 11 72917871 critical splice donor site probably null
R7175:Zzef1 UTSW 11 72851901 missense possibly damaging 0.49
R7284:Zzef1 UTSW 11 72886690 missense probably damaging 0.99
R7300:Zzef1 UTSW 11 72875004 missense probably benign 0.02
R7486:Zzef1 UTSW 11 72864786 missense possibly damaging 0.85
R7503:Zzef1 UTSW 11 72826067 missense probably damaging 1.00
R7679:Zzef1 UTSW 11 72893278 missense probably benign
R7874:Zzef1 UTSW 11 72859653 missense probably benign 0.01
R7898:Zzef1 UTSW 11 72796547 missense probably damaging 1.00
R7928:Zzef1 UTSW 11 72821896 missense probably damaging 0.99
R8021:Zzef1 UTSW 11 72823416 missense probably damaging 0.99
R8145:Zzef1 UTSW 11 72908469 nonsense probably null
R8255:Zzef1 UTSW 11 72875129 missense probably benign 0.00
R8303:Zzef1 UTSW 11 72917189 missense probably damaging 1.00
R8492:Zzef1 UTSW 11 72872604 missense probably damaging 1.00
R8492:Zzef1 UTSW 11 72886746 missense probably damaging 0.97
R8498:Zzef1 UTSW 11 72853322 missense probably damaging 1.00
R8547:Zzef1 UTSW 11 72844441 missense probably damaging 1.00
X0028:Zzef1 UTSW 11 72906979 missense probably benign 0.29
Z1176:Zzef1 UTSW 11 72796528 missense probably damaging 1.00
Z1177:Zzef1 UTSW 11 72796312 missense possibly damaging 0.91
Z1177:Zzef1 UTSW 11 72826178 missense probably damaging 1.00
Z1177:Zzef1 UTSW 11 72900631 critical splice acceptor site probably null
Z1177:Zzef1 UTSW 11 72915320 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGTGTAAATCCATCAGATAGCTG -3'
(R):5'- ACCAGACAGACATTCCTGGAG -3'

Sequencing Primer
(F):5'- TCAGATAGCTGATAAACTCTGAGGC -3'
(R):5'- CTCTTGGGAGACATCATCTAAGC -3'
Posted On2018-04-27