Incidental Mutation 'R6361:Rundc3a'
ID513130
Institutional Source Beutler Lab
Gene Symbol Rundc3a
Ensembl Gene ENSMUSG00000006575
Gene NameRUN domain containing 3A
SynonymsRpip8, Rap2ip
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R6361 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location102393403-102402555 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 102400795 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 358 (R358Q)
Ref Sequence ENSEMBL: ENSMUSP00000102720 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006750] [ENSMUST00000018821] [ENSMUST00000107098] [ENSMUST00000107102] [ENSMUST00000107103] [ENSMUST00000107105] [ENSMUST00000124755] [ENSMUST00000130436] [ENSMUST00000134669] [ENSMUST00000142097] [ENSMUST00000149777] [ENSMUST00000154001] [ENSMUST00000155104]
Predicted Effect probably damaging
Transcript: ENSMUST00000006750
AA Change: R363Q

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000006750
Gene: ENSMUSG00000006575
AA Change: R363Q

DomainStartEndE-ValueType
RUN 125 187 2.34e-19 SMART
coiled coil region 267 322 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000018821
SMART Domains Protein: ENSMUSP00000018821
Gene: ENSMUSG00000018677

DomainStartEndE-ValueType
Pfam:Mito_carr 7 156 6.9e-23 PFAM
Pfam:Mito_carr 158 247 6.1e-19 PFAM
Pfam:Mito_carr 251 352 1.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107098
SMART Domains Protein: ENSMUSP00000102715
Gene: ENSMUSG00000018677

DomainStartEndE-ValueType
Pfam:Mito_carr 7 148 1.4e-21 PFAM
Pfam:Mito_carr 150 240 3.7e-19 PFAM
Pfam:Mito_carr 243 344 4.6e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107102
AA Change: R363Q

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102719
Gene: ENSMUSG00000006575
AA Change: R363Q

DomainStartEndE-ValueType
RUN 125 187 2.34e-19 SMART
coiled coil region 267 322 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107103
AA Change: R358Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102720
Gene: ENSMUSG00000006575
AA Change: R358Q

DomainStartEndE-ValueType
RUN 120 182 2.34e-19 SMART
coiled coil region 262 317 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107105
AA Change: R371Q

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102722
Gene: ENSMUSG00000006575
AA Change: R371Q

DomainStartEndE-ValueType
RUN 125 187 2.34e-19 SMART
coiled coil region 267 320 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123688
Predicted Effect probably benign
Transcript: ENSMUST00000124755
SMART Domains Protein: ENSMUSP00000120021
Gene: ENSMUSG00000018677

DomainStartEndE-ValueType
Pfam:Mito_carr 7 71 1.3e-9 PFAM
Pfam:Mito_carr 92 152 9.7e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128331
Predicted Effect probably benign
Transcript: ENSMUST00000128825
SMART Domains Protein: ENSMUSP00000121790
Gene: ENSMUSG00000018677

DomainStartEndE-ValueType
Pfam:Mito_carr 35 77 6.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130436
SMART Domains Protein: ENSMUSP00000115087
Gene: ENSMUSG00000018677

DomainStartEndE-ValueType
Pfam:Mito_carr 7 70 1.8e-9 PFAM
Pfam:Mito_carr 92 156 5.7e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131219
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132876
Predicted Effect probably benign
Transcript: ENSMUST00000134669
SMART Domains Protein: ENSMUSP00000114481
Gene: ENSMUSG00000018677

DomainStartEndE-ValueType
Pfam:Mito_carr 7 69 1.9e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141535
Predicted Effect probably benign
Transcript: ENSMUST00000142097
SMART Domains Protein: ENSMUSP00000114365
Gene: ENSMUSG00000018677

DomainStartEndE-ValueType
Pfam:Mito_carr 7 63 2e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142157
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146330
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147160
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147860
Predicted Effect probably benign
Transcript: ENSMUST00000149777
SMART Domains Protein: ENSMUSP00000115365
Gene: ENSMUSG00000018677

DomainStartEndE-ValueType
Pfam:Mito_carr 7 70 2.7e-9 PFAM
Pfam:Mito_carr 92 156 8.7e-15 PFAM
Pfam:Mito_carr 158 220 6.5e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150982
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153395
Predicted Effect probably benign
Transcript: ENSMUST00000154001
SMART Domains Protein: ENSMUSP00000116336
Gene: ENSMUSG00000018677

DomainStartEndE-ValueType
Pfam:Mito_carr 7 70 3.1e-10 PFAM
Pfam:Mito_carr 92 156 9.8e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155104
SMART Domains Protein: ENSMUSP00000115445
Gene: ENSMUSG00000018677

DomainStartEndE-ValueType
Pfam:Mito_carr 7 69 3.7e-9 PFAM
Pfam:Mito_carr 92 156 1.2e-14 PFAM
Pfam:Mito_carr 158 248 5.4e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183859
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A T 4: 42,972,695 D676V probably benign Het
6430531B16Rik T A 7: 139,976,672 D134V possibly damaging Het
Asap1 C T 15: 64,349,823 probably null Het
Cabin1 G A 10: 75,726,865 A29V possibly damaging Het
Cadps G A 14: 12,491,778 Q791* probably null Het
Cdc14b T C 13: 64,216,209 probably null Het
Cep89 C T 7: 35,398,047 P33S probably damaging Het
Clec18a A G 8: 111,081,029 probably benign Het
Cln5 T A 14: 103,076,201 D296E probably benign Het
Col6a4 A T 9: 106,066,703 S1191T probably benign Het
Crispld1 A G 1: 17,762,231 I480M probably damaging Het
Dhrs7 A C 12: 72,664,659 L32V probably damaging Het
Dscam T C 16: 96,622,811 T1645A probably benign Het
Eif2b3 A G 4: 117,028,425 T55A possibly damaging Het
Ercc6 T C 14: 32,517,110 Y52H probably benign Het
Fam170b C A 14: 32,836,071 Q288K unknown Het
Flt4 A G 11: 49,630,578 T442A probably benign Het
Gm19402 A T 10: 77,690,061 probably benign Het
Gm4841 A G 18: 60,270,760 I87T probably damaging Het
Hspb7 A G 4: 141,422,549 E82G possibly damaging Het
Itgb3 A G 11: 104,665,582 K750E possibly damaging Het
Itsn2 A G 12: 4,629,655 M155V probably benign Het
March8 A T 6: 116,402,101 D332V probably null Het
Mst1r A G 9: 107,915,853 M1042V probably benign Het
Muc4 T C 16: 32,767,351 F2756L probably benign Het
Myl6b T A 10: 128,497,209 K55* probably null Het
Olfr1230 A T 2: 89,296,646 I208N probably damaging Het
Olfr1301 G T 2: 111,754,595 L115F probably damaging Het
Olfr150 A C 9: 39,737,672 N286H probably damaging Het
Olfr348 A G 2: 36,786,780 N85S probably damaging Het
Olfr830 T C 9: 18,875,731 Y132H probably damaging Het
Pcca A G 14: 122,638,382 D141G probably benign Het
Pkd2 C T 5: 104,486,680 R526* probably null Het
Polr2a C A 11: 69,743,337 A756S probably damaging Het
Prkd2 T C 7: 16,847,654 S145P probably damaging Het
Rhbdf1 T C 11: 32,212,915 N451D possibly damaging Het
Tbc1d4 T C 14: 101,507,174 K339E probably damaging Het
Usp37 A G 1: 74,453,893 I723T probably benign Het
Vwa2 A T 19: 56,901,526 probably null Het
Zdbf2 A C 1: 63,303,321 R286S possibly damaging Het
Zfp422 G A 6: 116,626,820 H73Y probably damaging Het
Zfp868 T C 8: 69,611,913 H257R probably damaging Het
Zzef1 A G 11: 72,884,349 S1723G possibly damaging Het
Other mutations in Rundc3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01150:Rundc3a APN 11 102393776 missense probably benign 0.43
IGL02206:Rundc3a APN 11 102399634 nonsense probably null
IGL02306:Rundc3a APN 11 102400938 missense probably damaging 1.00
IGL02838:Rundc3a APN 11 102397695 splice site probably benign
R0173:Rundc3a UTSW 11 102398245 unclassified probably benign
R1745:Rundc3a UTSW 11 102400913 frame shift probably null
R1746:Rundc3a UTSW 11 102400913 frame shift probably null
R2208:Rundc3a UTSW 11 102402088 missense probably damaging 1.00
R2366:Rundc3a UTSW 11 102397665 missense probably damaging 1.00
R2994:Rundc3a UTSW 11 102400663 missense probably damaging 1.00
R3755:Rundc3a UTSW 11 102399259 missense possibly damaging 0.48
R3756:Rundc3a UTSW 11 102399259 missense possibly damaging 0.48
R5519:Rundc3a UTSW 11 102402031 missense probably benign 0.01
R5748:Rundc3a UTSW 11 102399399 missense possibly damaging 0.63
R6722:Rundc3a UTSW 11 102399949 missense possibly damaging 0.73
R6819:Rundc3a UTSW 11 102398461 nonsense probably null
R7324:Rundc3a UTSW 11 102399973 missense possibly damaging 0.80
R7369:Rundc3a UTSW 11 102399895 missense probably damaging 1.00
R7437:Rundc3a UTSW 11 102398404 missense probably damaging 1.00
R7439:Rundc3a UTSW 11 102400046 critical splice donor site probably null
R7441:Rundc3a UTSW 11 102400046 critical splice donor site probably null
R7542:Rundc3a UTSW 11 102400045 missense probably benign 0.44
R7802:Rundc3a UTSW 11 102400009 missense probably benign 0.18
Z1176:Rundc3a UTSW 11 102400991 missense probably benign 0.02
Z1177:Rundc3a UTSW 11 102398452 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTTTCCGTCCTAAGCCCTG -3'
(R):5'- TTCTGAAGTGCCAAGGTGG -3'

Sequencing Primer
(F):5'- ACCTTTGCTGAGTCTCGC -3'
(R):5'- TGTGCTCACCGATGGGG -3'
Posted On2018-04-27