Incidental Mutation 'R6361:Pcca'
ID513139
Institutional Source Beutler Lab
Gene Symbol Pcca
Ensembl Gene ENSMUSG00000041650
Gene Namepropionyl-Coenzyme A carboxylase, alpha polypeptide
SynonymsC79630
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6361 (G1)
Quality Score203.009
Status Validated
Chromosome14
Chromosomal Location122534324-122891100 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122638382 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 141 (D141G)
Ref Sequence ENSEMBL: ENSMUSP00000123422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038374] [ENSMUST00000135578]
Predicted Effect probably benign
Transcript: ENSMUST00000038374
AA Change: D197G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000038763
Gene: ENSMUSG00000041650
AA Change: D197G

DomainStartEndE-ValueType
Pfam:CPSase_L_chain 58 167 2.1e-48 PFAM
Pfam:ATP-grasp_4 169 351 3.8e-15 PFAM
Pfam:RimK 170 372 5.6e-7 PFAM
Pfam:CPSase_L_D2 172 381 2.8e-87 PFAM
Pfam:ATP-grasp 181 351 9.8e-10 PFAM
Pfam:Dala_Dala_lig_C 192 349 7.7e-12 PFAM
Biotin_carb_C 393 501 4.27e-46 SMART
Pfam:Biotin_lipoyl 656 723 1e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135578
AA Change: D141G

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000123422
Gene: ENSMUSG00000041650
AA Change: D141G

DomainStartEndE-ValueType
Pfam:CPSase_L_chain 58 102 6.1e-15 PFAM
Pfam:CPSase_L_D2 116 163 9.9e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143240
Predicted Effect
Meta Mutation Damage Score 0.1450 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the alpha subunit of the heterodimeric mitochondrial enzyme Propionyl-CoA carboxylase. PCCA encodes the biotin-binding region of this enzyme. Mutations in either PCCA or PCCB (encoding the beta subunit) lead to an enzyme deficiency resulting in propionic acidemia. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2010]
PHENOTYPE: Homozygous null mice die 24-36 hours after birth due to accelerated ketoacidosis. Death is preceded by reduced milk intake, poor movement, dehydration, accumulation of propionyl-CoA, ketonuria, increased fat deposition and glycogen consumption in liver, and enlarged kidney collecting ducts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A T 4: 42,972,695 D676V probably benign Het
6430531B16Rik T A 7: 139,976,672 D134V possibly damaging Het
Asap1 C T 15: 64,349,823 probably null Het
Cabin1 G A 10: 75,726,865 A29V possibly damaging Het
Cadps G A 14: 12,491,778 Q791* probably null Het
Cdc14b T C 13: 64,216,209 probably null Het
Cep89 C T 7: 35,398,047 P33S probably damaging Het
Clec18a A G 8: 111,081,029 probably benign Het
Cln5 T A 14: 103,076,201 D296E probably benign Het
Col6a4 A T 9: 106,066,703 S1191T probably benign Het
Crispld1 A G 1: 17,762,231 I480M probably damaging Het
Dhrs7 A C 12: 72,664,659 L32V probably damaging Het
Dscam T C 16: 96,622,811 T1645A probably benign Het
Eif2b3 A G 4: 117,028,425 T55A possibly damaging Het
Ercc6 T C 14: 32,517,110 Y52H probably benign Het
Fam170b C A 14: 32,836,071 Q288K unknown Het
Flt4 A G 11: 49,630,578 T442A probably benign Het
Gm19402 A T 10: 77,690,061 probably benign Het
Gm4841 A G 18: 60,270,760 I87T probably damaging Het
Hspb7 A G 4: 141,422,549 E82G possibly damaging Het
Itgb3 A G 11: 104,665,582 K750E possibly damaging Het
Itsn2 A G 12: 4,629,655 M155V probably benign Het
March8 A T 6: 116,402,101 D332V probably null Het
Mst1r A G 9: 107,915,853 M1042V probably benign Het
Muc4 T C 16: 32,767,351 F2756L probably benign Het
Myl6b T A 10: 128,497,209 K55* probably null Het
Olfr1230 A T 2: 89,296,646 I208N probably damaging Het
Olfr1301 G T 2: 111,754,595 L115F probably damaging Het
Olfr150 A C 9: 39,737,672 N286H probably damaging Het
Olfr348 A G 2: 36,786,780 N85S probably damaging Het
Olfr830 T C 9: 18,875,731 Y132H probably damaging Het
Pkd2 C T 5: 104,486,680 R526* probably null Het
Polr2a C A 11: 69,743,337 A756S probably damaging Het
Prkd2 T C 7: 16,847,654 S145P probably damaging Het
Rhbdf1 T C 11: 32,212,915 N451D possibly damaging Het
Rundc3a G A 11: 102,400,795 R358Q probably damaging Het
Tbc1d4 T C 14: 101,507,174 K339E probably damaging Het
Usp37 A G 1: 74,453,893 I723T probably benign Het
Vwa2 A T 19: 56,901,526 probably null Het
Zdbf2 A C 1: 63,303,321 R286S possibly damaging Het
Zfp422 G A 6: 116,626,820 H73Y probably damaging Het
Zfp868 T C 8: 69,611,913 H257R probably damaging Het
Zzef1 A G 11: 72,884,349 S1723G possibly damaging Het
Other mutations in Pcca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Pcca APN 14 122582629 missense probably benign 0.22
IGL00906:Pcca APN 14 122690133 missense probably benign 0.34
IGL00975:Pcca APN 14 122876900 missense probably damaging 1.00
IGL01329:Pcca APN 14 122690133 missense possibly damaging 0.50
IGL01353:Pcca APN 14 122582617 missense probably damaging 0.98
IGL01672:Pcca APN 14 122690145 missense probably benign 0.02
IGL02621:Pcca APN 14 122684979 missense probably damaging 0.99
IGL02695:Pcca APN 14 122582738 splice site probably benign
IGL02749:Pcca APN 14 122534388 missense probably benign 0.00
IGL02971:Pcca APN 14 122889533 missense probably damaging 0.96
IGL03290:Pcca APN 14 122585106 missense possibly damaging 0.52
IGL03052:Pcca UTSW 14 122887101 missense probably benign
PIT4812001:Pcca UTSW 14 122790382 missense probably benign 0.00
R0549:Pcca UTSW 14 122638377 splice site probably benign
R0866:Pcca UTSW 14 122889545 missense possibly damaging 0.95
R1498:Pcca UTSW 14 122616818 missense probably damaging 1.00
R1749:Pcca UTSW 14 122701130 missense probably damaging 0.97
R2002:Pcca UTSW 14 122887065 missense probably benign 0.00
R2020:Pcca UTSW 14 122813222 missense possibly damaging 0.64
R2086:Pcca UTSW 14 122686115 missense probably damaging 0.99
R3780:Pcca UTSW 14 122684885 missense probably damaging 1.00
R5023:Pcca UTSW 14 122790398 missense probably damaging 1.00
R5643:Pcca UTSW 14 122887069 missense probably damaging 1.00
R5644:Pcca UTSW 14 122887069 missense probably damaging 1.00
R5943:Pcca UTSW 14 122658776 missense probably damaging 0.99
R5966:Pcca UTSW 14 122668586 missense probably damaging 0.96
R6295:Pcca UTSW 14 122658775 missense probably benign 0.10
R6317:Pcca UTSW 14 122582623 missense probably damaging 1.00
R6319:Pcca UTSW 14 122582623 missense probably damaging 1.00
R6989:Pcca UTSW 14 122650288 missense probably damaging 1.00
R7243:Pcca UTSW 14 122876774 missense probably benign
R7841:Pcca UTSW 14 122562972 missense probably benign 0.03
R8026:Pcca UTSW 14 122638382 missense probably benign 0.07
RF024:Pcca UTSW 14 122684898 missense probably damaging 1.00
X0026:Pcca UTSW 14 122616791 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- GCCAGCTCATTTCAAACTGC -3'
(R):5'- CTAAGATCAAGTGACTACAAGTCCTAC -3'

Sequencing Primer
(F):5'- CGACGAAGGAGAATTTACATTCC -3'
(R):5'- TTCAACTGATAAATTCTAGAGCCAC -3'
Posted On2018-04-27