Incidental Mutation 'R6361:Vwa2'
ID513144
Institutional Source Beutler Lab
Gene Symbol Vwa2
Ensembl Gene ENSMUSG00000025082
Gene Namevon Willebrand factor A domain containing 2
SynonymsAmaco
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6361 (G1)
Quality Score158.009
Status Validated
Chromosome19
Chromosomal Location56874249-56912078 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to T at 56901526 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000026068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026068]
Predicted Effect probably null
Transcript: ENSMUST00000026068
SMART Domains Protein: ENSMUSP00000026068
Gene: ENSMUSG00000025082

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
VWA 49 222 6.9e-35 SMART
EGF 297 332 2.99e-4 SMART
VWA 340 517 1.26e-28 SMART
VWA 528 705 1.55e-37 SMART
EGF 714 747 5e-6 SMART
Meta Mutation Damage Score 0.9486 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the von Willebrand factor A-like domain protein superfamily. The encoded protein is localized to the extracellular matrix and may serve as a structural component in basement membranes or in anchoring structures on scaffolds of collagen VII or fibrillin. This gene has been linked to type 1A diabetes and is a candidate serological marker for colon cancer. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A T 4: 42,972,695 D676V probably benign Het
6430531B16Rik T A 7: 139,976,672 D134V possibly damaging Het
Asap1 C T 15: 64,349,823 probably null Het
Cabin1 G A 10: 75,726,865 A29V possibly damaging Het
Cadps G A 14: 12,491,778 Q791* probably null Het
Cdc14b T C 13: 64,216,209 probably null Het
Cep89 C T 7: 35,398,047 P33S probably damaging Het
Clec18a A G 8: 111,081,029 probably benign Het
Cln5 T A 14: 103,076,201 D296E probably benign Het
Col6a4 A T 9: 106,066,703 S1191T probably benign Het
Crispld1 A G 1: 17,762,231 I480M probably damaging Het
Dhrs7 A C 12: 72,664,659 L32V probably damaging Het
Dscam T C 16: 96,622,811 T1645A probably benign Het
Eif2b3 A G 4: 117,028,425 T55A possibly damaging Het
Ercc6 T C 14: 32,517,110 Y52H probably benign Het
Fam170b C A 14: 32,836,071 Q288K unknown Het
Flt4 A G 11: 49,630,578 T442A probably benign Het
Gm19402 A T 10: 77,690,061 probably benign Het
Gm4841 A G 18: 60,270,760 I87T probably damaging Het
Hspb7 A G 4: 141,422,549 E82G possibly damaging Het
Itgb3 A G 11: 104,665,582 K750E possibly damaging Het
Itsn2 A G 12: 4,629,655 M155V probably benign Het
March8 A T 6: 116,402,101 D332V probably null Het
Mst1r A G 9: 107,915,853 M1042V probably benign Het
Muc4 T C 16: 32,767,351 F2756L probably benign Het
Myl6b T A 10: 128,497,209 K55* probably null Het
Olfr1230 A T 2: 89,296,646 I208N probably damaging Het
Olfr1301 G T 2: 111,754,595 L115F probably damaging Het
Olfr150 A C 9: 39,737,672 N286H probably damaging Het
Olfr348 A G 2: 36,786,780 N85S probably damaging Het
Olfr830 T C 9: 18,875,731 Y132H probably damaging Het
Pcca A G 14: 122,638,382 D141G probably benign Het
Pkd2 C T 5: 104,486,680 R526* probably null Het
Polr2a C A 11: 69,743,337 A756S probably damaging Het
Prkd2 T C 7: 16,847,654 S145P probably damaging Het
Rhbdf1 T C 11: 32,212,915 N451D possibly damaging Het
Rundc3a G A 11: 102,400,795 R358Q probably damaging Het
Tbc1d4 T C 14: 101,507,174 K339E probably damaging Het
Usp37 A G 1: 74,453,893 I723T probably benign Het
Zdbf2 A C 1: 63,303,321 R286S possibly damaging Het
Zfp422 G A 6: 116,626,820 H73Y probably damaging Het
Zfp868 T C 8: 69,611,913 H257R probably damaging Het
Zzef1 A G 11: 72,884,349 S1723G possibly damaging Het
Other mutations in Vwa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01147:Vwa2 APN 19 56901634 missense probably damaging 0.98
IGL02081:Vwa2 APN 19 56902236 missense probably benign 0.00
IGL02738:Vwa2 APN 19 56897929 missense possibly damaging 0.62
H8786:Vwa2 UTSW 19 56909732 missense possibly damaging 0.90
R0510:Vwa2 UTSW 19 56898068 splice site probably benign
R1061:Vwa2 UTSW 19 56908994 missense probably benign 0.35
R1350:Vwa2 UTSW 19 56909126 missense probably damaging 1.00
R1403:Vwa2 UTSW 19 56881138 missense unknown
R1403:Vwa2 UTSW 19 56881138 missense unknown
R1918:Vwa2 UTSW 19 56908934 missense probably benign 0.07
R2046:Vwa2 UTSW 19 56905578 missense probably benign 0.08
R3943:Vwa2 UTSW 19 56909315 missense probably damaging 1.00
R4278:Vwa2 UTSW 19 56903483 missense probably benign 0.00
R4745:Vwa2 UTSW 19 56906886 missense probably benign
R5081:Vwa2 UTSW 19 56909320 missense probably damaging 1.00
R5750:Vwa2 UTSW 19 56909231 missense probably benign 0.00
R5959:Vwa2 UTSW 19 56881172 missense possibly damaging 0.96
R6151:Vwa2 UTSW 19 56903465 critical splice acceptor site probably null
R6861:Vwa2 UTSW 19 56901593 missense probably benign 0.03
R7286:Vwa2 UTSW 19 56909359 missense probably benign
R7653:Vwa2 UTSW 19 56909335 missense probably benign 0.00
R7752:Vwa2 UTSW 19 56909240 missense probably damaging 1.00
R8038:Vwa2 UTSW 19 56897888 missense probably benign 0.43
X0020:Vwa2 UTSW 19 56909201 missense probably damaging 1.00
X0066:Vwa2 UTSW 19 56886985 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CTTTGTCTGCCGATGAGCAG -3'
(R):5'- AGTCTGTAAGGTTCAAGGCTATTC -3'

Sequencing Primer
(F):5'- GTTTGAGGACAAGGCGTTTAG -3'
(R):5'- AAGGCTATTCCCTTGCAGG -3'
Posted On2018-04-27