Incidental Mutation 'R6332:Slco5a1'
ID513145
Institutional Source Beutler Lab
Gene Symbol Slco5a1
Ensembl Gene ENSMUSG00000025938
Gene Namesolute carrier organic anion transporter family, member 5A1
SynonymsA630033C23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R6332 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location12866549-12992650 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 12921185 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 427 (V427I)
Ref Sequence ENSEMBL: ENSMUSP00000140658 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115402] [ENSMUST00000115403] [ENSMUST00000136197] [ENSMUST00000146763] [ENSMUST00000147606] [ENSMUST00000188454]
Predicted Effect probably benign
Transcript: ENSMUST00000115402
AA Change: V427I

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000111061
Gene: ENSMUSG00000025938
AA Change: V427I

DomainStartEndE-ValueType
low complexity region 80 93 N/A INTRINSIC
Pfam:MFS_1 137 548 3e-28 PFAM
KAZAL 559 602 3.26e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115403
AA Change: V427I

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000111062
Gene: ENSMUSG00000025938
AA Change: V427I

DomainStartEndE-ValueType
low complexity region 80 93 N/A INTRINSIC
Pfam:MFS_1 137 547 2.8e-28 PFAM
KAZAL 559 602 3.26e-2 SMART
transmembrane domain 737 759 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133201
Predicted Effect probably benign
Transcript: ENSMUST00000136197
AA Change: V427I

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000139533
Gene: ENSMUSG00000025938
AA Change: V427I

DomainStartEndE-ValueType
low complexity region 80 93 N/A INTRINSIC
Pfam:MFS_1 137 548 3.6e-27 PFAM
KAZAL 559 601 4.3e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146763
SMART Domains Protein: ENSMUSP00000139586
Gene: ENSMUSG00000025938

DomainStartEndE-ValueType
low complexity region 80 93 N/A INTRINSIC
Pfam:OATP 130 352 8.4e-72 PFAM
Pfam:MFS_1 137 332 1.6e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147606
AA Change: V427I

PolyPhen 2 Score 0.272 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000140658
Gene: ENSMUSG00000025938
AA Change: V427I

DomainStartEndE-ValueType
low complexity region 80 93 N/A INTRINSIC
Pfam:OATP 130 478 1.5e-105 PFAM
Pfam:MFS_1 137 476 2.3e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188454
AA Change: V427I

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000140091
Gene: ENSMUSG00000025938
AA Change: V427I

DomainStartEndE-ValueType
low complexity region 80 93 N/A INTRINSIC
Pfam:MFS_1 137 548 4.1e-28 PFAM
KAZAL 559 602 3.26e-2 SMART
transmembrane domain 737 759 N/A INTRINSIC
Meta Mutation Damage Score 0.1177 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 12 transmembrane domain protein that is a member of the solute carrier organic anion transporter superfamily. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933421I07Rik C A 7: 42,446,243 G194C possibly damaging Het
Adamtsl1 A G 4: 86,217,011 K258E probably damaging Het
Afdn A T 17: 13,810,445 D206V possibly damaging Het
Agt G T 8: 124,557,833 Q389K possibly damaging Het
Ankrd44 A T 1: 54,762,273 D298E probably damaging Het
Anks1 A G 17: 28,052,735 S897G probably benign Het
Apol9b A G 15: 77,735,546 probably null Het
Baz1a T C 12: 54,918,554 E705G probably benign Het
BC048679 C T 7: 81,495,218 V126M probably benign Het
Cep295 A G 9: 15,334,914 F749L possibly damaging Het
Cntrl T A 2: 35,128,024 I482K possibly damaging Het
Col6a3 A G 1: 90,822,233 F293S probably damaging Het
Dnah12 T G 14: 26,717,974 M527R probably damaging Het
Dnhd1 G A 7: 105,694,066 R1539H probably benign Het
Ece1 A G 4: 137,958,008 Y603C probably damaging Het
Eea1 G A 10: 96,041,473 A1350T possibly damaging Het
Exoc3l4 A T 12: 111,427,968 K507N possibly damaging Het
Fam126b T A 1: 58,529,875 Y515F probably damaging Het
Fam35a A G 14: 34,268,172 V259A probably benign Het
Flt3l A T 7: 45,133,667 probably null Het
Fn1 T C 1: 71,628,071 Q834R probably benign Het
Haus5 C T 7: 30,658,976 W298* probably null Het
Ifih1 T C 2: 62,639,483 N157D possibly damaging Het
Itga2 A C 13: 114,843,473 M1064R probably benign Het
Itgae A G 11: 73,111,402 probably null Het
Krtap10-4 T C 10: 77,827,049 probably benign Het
Lamp3 A G 16: 19,699,681 C269R probably damaging Het
Lrp5 T C 19: 3,659,355 D125G probably damaging Het
Matn2 A C 15: 34,423,755 E586D probably benign Het
Mef2b T A 8: 70,164,139 probably null Het
Mrps22 A G 9: 98,601,471 probably null Het
Mtmr2 T C 9: 13,800,029 F445L probably damaging Het
Nxph4 A G 10: 127,526,368 V218A probably damaging Het
Olfr1308 C T 2: 111,960,746 G109D probably damaging Het
Olfr382 A G 11: 73,517,175 V8A probably benign Het
Olfr639 A G 7: 104,011,773 S310P probably benign Het
Pdpk1 A T 17: 24,106,922 V100D probably damaging Het
Phldb2 A C 16: 45,774,246 S899A probably benign Het
Pnpla3 G A 15: 84,172,782 probably null Het
Rasal2 A G 1: 157,299,187 Y94H probably damaging Het
Rlf A T 4: 121,148,822 I987N possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rprd2 A G 3: 95,780,441 Y300H probably damaging Het
Setbp1 G A 18: 78,783,369 S1343L probably benign Het
Sfswap A G 5: 129,571,041 K938E possibly damaging Het
Slc3a1 A C 17: 85,028,432 M1L probably damaging Het
Ssbp2 A T 13: 91,690,908 M300L probably benign Het
Ssc5d A G 7: 4,937,522 D878G probably damaging Het
Stk19 A G 17: 34,824,598 L212P probably damaging Het
Stk39 T C 2: 68,410,043 M115V possibly damaging Het
Syt17 A C 7: 118,434,243 S181A probably benign Het
Taar7b A T 10: 23,999,951 N5Y probably benign Het
Tmc4 A G 7: 3,677,422 probably null Het
Tmem248 T A 5: 130,229,469 M1K probably null Het
Tmem82 T A 4: 141,616,410 Q183L probably damaging Het
Tpd52l1 T C 10: 31,338,207 E142G probably damaging Het
Ttll2 A T 17: 7,351,768 H253Q probably damaging Het
Ttn T C 2: 76,857,464 probably benign Het
Ubd A G 17: 37,195,501 K93E probably benign Het
Ugt2b35 T A 5: 87,001,556 F222Y probably damaging Het
Vmn2r10 G T 5: 109,003,462 N95K probably damaging Het
Vwa8 T C 14: 79,197,464 V1775A probably benign Het
Zdbf2 A G 1: 63,307,822 K1787E possibly damaging Het
Zfp26 A T 9: 20,437,286 F661I probably damaging Het
Zfp735 A T 11: 73,711,678 K483* probably null Het
Zfp946 A G 17: 22,454,538 E91G probably damaging Het
Zic5 C A 14: 122,459,749 D485Y unknown Het
Zmynd8 A T 2: 165,838,852 D236E probably damaging Het
Other mutations in Slco5a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02264:Slco5a1 APN 1 12871995 missense probably benign 0.01
IGL02330:Slco5a1 APN 1 12939060 missense probably damaging 1.00
IGL02660:Slco5a1 APN 1 12989636 missense probably damaging 1.00
IGL02904:Slco5a1 APN 1 12921097 missense probably damaging 0.98
IGL02972:Slco5a1 APN 1 12990155 nonsense probably null
IGL03100:Slco5a1 APN 1 12879280 missense possibly damaging 0.67
IGL03270:Slco5a1 APN 1 12872028 missense probably benign
R0969:Slco5a1 UTSW 1 12989892 missense probably damaging 1.00
R1337:Slco5a1 UTSW 1 12939142 missense probably benign 0.01
R1434:Slco5a1 UTSW 1 12871908 missense probably benign 0.00
R1627:Slco5a1 UTSW 1 12990383 missense probably damaging 1.00
R1767:Slco5a1 UTSW 1 12989615 missense probably damaging 1.00
R1893:Slco5a1 UTSW 1 12894472 missense probably damaging 1.00
R1894:Slco5a1 UTSW 1 12872259 missense probably damaging 1.00
R2301:Slco5a1 UTSW 1 12879262 missense probably damaging 0.98
R2302:Slco5a1 UTSW 1 12879262 missense probably damaging 0.98
R2303:Slco5a1 UTSW 1 12879262 missense probably damaging 0.98
R2304:Slco5a1 UTSW 1 12879262 missense probably damaging 0.98
R2349:Slco5a1 UTSW 1 12921152 missense probably damaging 1.00
R2351:Slco5a1 UTSW 1 12989934 missense probably benign 0.05
R3079:Slco5a1 UTSW 1 12879262 missense probably damaging 0.98
R3949:Slco5a1 UTSW 1 12989609 missense probably damaging 1.00
R4197:Slco5a1 UTSW 1 12894516 missense probably damaging 1.00
R4380:Slco5a1 UTSW 1 12939168 missense probably damaging 0.96
R4532:Slco5a1 UTSW 1 12879223 missense probably damaging 1.00
R4750:Slco5a1 UTSW 1 12879280 missense probably damaging 1.00
R5891:Slco5a1 UTSW 1 12990402 missense probably benign 0.04
R6024:Slco5a1 UTSW 1 12944070 missense probably damaging 1.00
R6492:Slco5a1 UTSW 1 12989927 missense probably damaging 1.00
R6860:Slco5a1 UTSW 1 12881196 intron probably benign
R6994:Slco5a1 UTSW 1 12881393 missense probably damaging 1.00
R7121:Slco5a1 UTSW 1 12990437 missense probably benign 0.00
R7747:Slco5a1 UTSW 1 12990122 missense probably benign 0.05
R7802:Slco5a1 UTSW 1 12990476 missense possibly damaging 0.76
R7895:Slco5a1 UTSW 1 12989703 missense possibly damaging 0.52
R7978:Slco5a1 UTSW 1 12989703 missense possibly damaging 0.52
RF010:Slco5a1 UTSW 1 12871947 missense probably damaging 1.00
X0065:Slco5a1 UTSW 1 12872212 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTAAGCAGCCCTAGCGG -3'
(R):5'- TCAAGTGTCATCAGAAGCGG -3'

Sequencing Primer
(F):5'- GCAGTGCCTTACCAGTGTAG -3'
(R):5'- CTACAGAGTAGATTCCTGGATAGCC -3'
Posted On2018-04-27