Mutagenetix > Incidental Mutations

Incidental Mutation 'R6332:Rasal2'

513151

Institutional Source

Beutler Lab

Gene Symbol

Rasal2

Ensembl Gene

ENSMUSG00000070565

Gene Name

RAS protein activator like 2

Synonyms

A330066M24Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6332 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

157135182-157412595 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 157299187 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 94 (Y94H)

Ref Sequence

ENSEMBL: ENSMUSP00000077423 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078308] [ENSMUST00000132699]

Predicted Effect

probably damaging
Transcript: ENSMUST00000078308
AA Change: Y94H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000077423
Gene: ENSMUSG00000070565
AA Change: Y94H

Domain	Start	End	E-Value	Type
low complexity region	36	47	N/A	INTRINSIC
PH	58	307	3.97e-8	SMART
C2	317	413	6.01e-10	SMART
RasGAP	423	767	4.56e-157	SMART
low complexity region	780	791	N/A	INTRINSIC
low complexity region	1063	1075	N/A	INTRINSIC
low complexity region	1084	1092	N/A	INTRINSIC
coiled coil region	1117	1236	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000132699
AA Change: Y76H

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000114964
Gene: ENSMUSG00000070565
AA Change: Y76H

Domain	Start	End	E-Value	Type
low complexity region	18	29	N/A	INTRINSIC
PH	40	289	1.7e-10	SMART
C2	299	395	4e-12	SMART
RasGAP	405	742	4.2e-153	SMART
low complexity region	755	766	N/A	INTRINSIC
low complexity region	1038	1050	N/A	INTRINSIC
low complexity region	1059	1067	N/A	INTRINSIC
coiled coil region	1092	1211	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143080

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.2%

Validation Efficiency

99% (67/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains the GAP-related domain (GRD), a characteristic domain of GTPase-activating proteins (GAPs). GAPs function as activators of Ras superfamily of small GTPases. The protein encoded by this gene is able to complement the defective RasGAP function in a yeast system. Two alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit reduced survival and decreased tumor latency. In other tumorigenic models, this allele promotes increase metastatic potential. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933421I07Rik	C	A	7: 42,446,243	G194C	possibly damaging	Het
Adamtsl1	A	G	4: 86,217,011	K258E	probably damaging	Het
Afdn	A	T	17: 13,810,445	D206V	possibly damaging	Het
Agt	G	T	8: 124,557,833	Q389K	possibly damaging	Het
Ankrd44	A	T	1: 54,762,273	D298E	probably damaging	Het
Anks1	A	G	17: 28,052,735	S897G	probably benign	Het
Apol9b	A	G	15: 77,735,546		probably null	Het
Baz1a	T	C	12: 54,918,554	E705G	probably benign	Het
BC048679	C	T	7: 81,495,218	V126M	probably benign	Het
Cep295	A	G	9: 15,334,914	F749L	possibly damaging	Het
Cntrl	T	A	2: 35,128,024	I482K	possibly damaging	Het
Col6a3	A	G	1: 90,822,233	F293S	probably damaging	Het
Dnah12	T	G	14: 26,717,974	M527R	probably damaging	Het
Dnhd1	G	A	7: 105,694,066	R1539H	probably benign	Het
Ece1	A	G	4: 137,958,008	Y603C	probably damaging	Het
Eea1	G	A	10: 96,041,473	A1350T	possibly damaging	Het
Exoc3l4	A	T	12: 111,427,968	K507N	possibly damaging	Het
Fam126b	T	A	1: 58,529,875	Y515F	probably damaging	Het
Fam35a	A	G	14: 34,268,172	V259A	probably benign	Het
Flt3l	A	T	7: 45,133,667		probably null	Het
Fn1	T	C	1: 71,628,071	Q834R	probably benign	Het
Haus5	C	T	7: 30,658,976	W298*	probably null	Het
Ifih1	T	C	2: 62,639,483	N157D	possibly damaging	Het
Itga2	A	C	13: 114,843,473	M1064R	probably benign	Het
Itgae	A	G	11: 73,111,402		probably null	Het
Krtap10-4	T	C	10: 77,827,049		probably benign	Het
Lamp3	A	G	16: 19,699,681	C269R	probably damaging	Het
Lrp5	T	C	19: 3,659,355	D125G	probably damaging	Het
Matn2	A	C	15: 34,423,755	E586D	probably benign	Het
Mef2b	T	A	8: 70,164,139		probably null	Het
Mrps22	A	G	9: 98,601,471		probably null	Het
Mtmr2	T	C	9: 13,800,029	F445L	probably damaging	Het
Nxph4	A	G	10: 127,526,368	V218A	probably damaging	Het
Olfr1308	C	T	2: 111,960,746	G109D	probably damaging	Het
Olfr382	A	G	11: 73,517,175	V8A	probably benign	Het
Olfr639	A	G	7: 104,011,773	S310P	probably benign	Het
Pdpk1	A	T	17: 24,106,922	V100D	probably damaging	Het
Phldb2	A	C	16: 45,774,246	S899A	probably benign	Het
Pnpla3	G	A	15: 84,172,782		probably null	Het
Rlf	A	T	4: 121,148,822	I987N	possibly damaging	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
Rprd2	A	G	3: 95,780,441	Y300H	probably damaging	Het
Setbp1	G	A	18: 78,783,369	S1343L	probably benign	Het
Sfswap	A	G	5: 129,571,041	K938E	possibly damaging	Het
Slc3a1	A	C	17: 85,028,432	M1L	probably damaging	Het
Slco5a1	C	T	1: 12,921,185	V427I	probably benign	Het
Ssbp2	A	T	13: 91,690,908	M300L	probably benign	Het
Ssc5d	A	G	7: 4,937,522	D878G	probably damaging	Het
Stk19	A	G	17: 34,824,598	L212P	probably damaging	Het
Stk39	T	C	2: 68,410,043	M115V	possibly damaging	Het
Syt17	A	C	7: 118,434,243	S181A	probably benign	Het
Taar7b	A	T	10: 23,999,951	N5Y	probably benign	Het
Tmc4	A	G	7: 3,677,422		probably null	Het
Tmem248	T	A	5: 130,229,469	M1K	probably null	Het
Tmem82	T	A	4: 141,616,410	Q183L	probably damaging	Het
Tpd52l1	T	C	10: 31,338,207	E142G	probably damaging	Het
Ttll2	A	T	17: 7,351,768	H253Q	probably damaging	Het
Ttn	T	C	2: 76,857,464		probably benign	Het
Ubd	A	G	17: 37,195,501	K93E	probably benign	Het
Ugt2b35	T	A	5: 87,001,556	F222Y	probably damaging	Het
Vmn2r10	G	T	5: 109,003,462	N95K	probably damaging	Het
Vwa8	T	C	14: 79,197,464	V1775A	probably benign	Het
Zdbf2	A	G	1: 63,307,822	K1787E	possibly damaging	Het
Zfp26	A	T	9: 20,437,286	F661I	probably damaging	Het
Zfp735	A	T	11: 73,711,678	K483*	probably null	Het
Zfp946	A	G	17: 22,454,538	E91G	probably damaging	Het
Zic5	C	A	14: 122,459,749	D485Y	unknown	Het
Zmynd8	A	T	2: 165,838,852	D236E	probably damaging	Het

Other mutations in Rasal2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00473:Rasal2	APN	1	157147817	missense	probably benign
IGL00484:Rasal2	APN	1	157174175	unclassified	probably null
IGL00731:Rasal2	APN	1	157157764	missense	probably benign	0.01
IGL00900:Rasal2	APN	1	157411929	missense	possibly damaging	0.73
IGL01346:Rasal2	APN	1	157161216	missense	probably benign	0.19
IGL01635:Rasal2	APN	1	157163824	missense	probably damaging	1.00
IGL01759:Rasal2	APN	1	157175932	missense	probably benign	0.42
IGL01939:Rasal2	APN	1	157175910	missense	probably damaging	1.00
IGL01954:Rasal2	APN	1	157177699	missense	possibly damaging	0.83
IGL01954:Rasal2	APN	1	157176116	missense	probably damaging	0.99
IGL02005:Rasal2	APN	1	157156998	nonsense	probably null
IGL02056:Rasal2	APN	1	157299261	missense	probably damaging	0.99
IGL02444:Rasal2	APN	1	157299195	missense	probably benign	0.20
IGL02496:Rasal2	APN	1	157149879	missense	possibly damaging	0.69
IGL02832:Rasal2	APN	1	157157207	missense	probably damaging	1.00
IGL03351:Rasal2	APN	1	157192741	splice site	probably benign
R0456:Rasal2	UTSW	1	157149843	missense	probably damaging	1.00
R0537:Rasal2	UTSW	1	157147792	missense	possibly damaging	0.46
R0681:Rasal2	UTSW	1	157157180	missense	possibly damaging	0.70
R0682:Rasal2	UTSW	1	157179209	missense	probably damaging	1.00
R0683:Rasal2	UTSW	1	157179209	missense	probably damaging	1.00
R0787:Rasal2	UTSW	1	157158696	missense	probably damaging	1.00
R0789:Rasal2	UTSW	1	157157321	missense	probably damaging	1.00
R1109:Rasal2	UTSW	1	157177638	unclassified	probably benign
R1175:Rasal2	UTSW	1	157147648	missense	probably damaging	1.00
R1332:Rasal2	UTSW	1	157175821	missense	probably benign	0.00
R1396:Rasal2	UTSW	1	157164666	missense	probably damaging	1.00
R1535:Rasal2	UTSW	1	157230059	missense	probably benign	0.28
R1542:Rasal2	UTSW	1	157175851	missense	possibly damaging	0.84
R1703:Rasal2	UTSW	1	157157600	missense	probably damaging	1.00
R1735:Rasal2	UTSW	1	157174160	missense	probably damaging	1.00
R1762:Rasal2	UTSW	1	157299144	missense	possibly damaging	0.52
R2570:Rasal2	UTSW	1	157161300	missense	possibly damaging	0.85
R3148:Rasal2	UTSW	1	157243764	intron	probably benign
R3157:Rasal2	UTSW	1	157158655	splice site	probably benign
R4277:Rasal2	UTSW	1	157157126	missense	possibly damaging	0.46
R4459:Rasal2	UTSW	1	157175832	missense	possibly damaging	0.46
R4460:Rasal2	UTSW	1	157175832	missense	possibly damaging	0.46
R4563:Rasal2	UTSW	1	157175991	missense	probably damaging	1.00
R4672:Rasal2	UTSW	1	157243661	missense	probably benign	0.10
R4894:Rasal2	UTSW	1	157192804	missense	probably damaging	0.97
R5147:Rasal2	UTSW	1	157175694	missense	probably damaging	1.00
R5387:Rasal2	UTSW	1	157157765	missense	possibly damaging	0.81
R5421:Rasal2	UTSW	1	157299141	missense	probably benign	0.37
R5459:Rasal2	UTSW	1	157157661	missense	probably damaging	0.99
R5651:Rasal2	UTSW	1	157157381	missense	probably damaging	1.00
R5767:Rasal2	UTSW	1	157176162	missense	probably damaging	1.00
R5778:Rasal2	UTSW	1	157161290	missense	probably damaging	1.00
R6298:Rasal2	UTSW	1	157411862	missense	possibly damaging	0.85
R6571:Rasal2	UTSW	1	157161179	missense	possibly damaging	0.72
R7258:Rasal2	UTSW	1	157157700	missense	probably damaging	0.96
R7545:Rasal2	UTSW	1	157192769	missense	possibly damaging	0.93
R7558:Rasal2	UTSW	1	157175836	missense	probably damaging	0.99
R7894:Rasal2	UTSW	1	157243648	missense	probably benign	0.01
R7977:Rasal2	UTSW	1	157243648	missense	probably benign	0.01
RF024:Rasal2	UTSW	1	157147790	missense	probably damaging	0.97
Z1177:Rasal2	UTSW	1	157175673	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CACTTACACTACAGTTTATGGTTGC -3'
(R):5'- AAACAGCCTCCCATTGTCTC -3'

Sequencing Primer
(F):5'- CACTACAGTTTATGGTTGCTAGAGTC -3'
(R):5'- AGCCTCCCATTGTCTCAATGTAAAC -3'

Posted On

2018-04-27