Incidental Mutation 'R6332:Rasal2'
ID513151
Institutional Source Beutler Lab
Gene Symbol Rasal2
Ensembl Gene ENSMUSG00000070565
Gene NameRAS protein activator like 2
SynonymsA330066M24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6332 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location157135182-157412595 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 157299187 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 94 (Y94H)
Ref Sequence ENSEMBL: ENSMUSP00000077423 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078308] [ENSMUST00000132699]
Predicted Effect probably damaging
Transcript: ENSMUST00000078308
AA Change: Y94H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000077423
Gene: ENSMUSG00000070565
AA Change: Y94H

DomainStartEndE-ValueType
low complexity region 36 47 N/A INTRINSIC
PH 58 307 3.97e-8 SMART
C2 317 413 6.01e-10 SMART
RasGAP 423 767 4.56e-157 SMART
low complexity region 780 791 N/A INTRINSIC
low complexity region 1063 1075 N/A INTRINSIC
low complexity region 1084 1092 N/A INTRINSIC
coiled coil region 1117 1236 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000132699
AA Change: Y76H

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000114964
Gene: ENSMUSG00000070565
AA Change: Y76H

DomainStartEndE-ValueType
low complexity region 18 29 N/A INTRINSIC
PH 40 289 1.7e-10 SMART
C2 299 395 4e-12 SMART
RasGAP 405 742 4.2e-153 SMART
low complexity region 755 766 N/A INTRINSIC
low complexity region 1038 1050 N/A INTRINSIC
low complexity region 1059 1067 N/A INTRINSIC
coiled coil region 1092 1211 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143080
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains the GAP-related domain (GRD), a characteristic domain of GTPase-activating proteins (GAPs). GAPs function as activators of Ras superfamily of small GTPases. The protein encoded by this gene is able to complement the defective RasGAP function in a yeast system. Two alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit reduced survival and decreased tumor latency. In other tumorigenic models, this allele promotes increase metastatic potential. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933421I07Rik C A 7: 42,446,243 G194C possibly damaging Het
Adamtsl1 A G 4: 86,217,011 K258E probably damaging Het
Afdn A T 17: 13,810,445 D206V possibly damaging Het
Agt G T 8: 124,557,833 Q389K possibly damaging Het
Ankrd44 A T 1: 54,762,273 D298E probably damaging Het
Anks1 A G 17: 28,052,735 S897G probably benign Het
Apol9b A G 15: 77,735,546 probably null Het
Baz1a T C 12: 54,918,554 E705G probably benign Het
BC048679 C T 7: 81,495,218 V126M probably benign Het
Cep295 A G 9: 15,334,914 F749L possibly damaging Het
Cntrl T A 2: 35,128,024 I482K possibly damaging Het
Col6a3 A G 1: 90,822,233 F293S probably damaging Het
Dnah12 T G 14: 26,717,974 M527R probably damaging Het
Dnhd1 G A 7: 105,694,066 R1539H probably benign Het
Ece1 A G 4: 137,958,008 Y603C probably damaging Het
Eea1 G A 10: 96,041,473 A1350T possibly damaging Het
Exoc3l4 A T 12: 111,427,968 K507N possibly damaging Het
Fam126b T A 1: 58,529,875 Y515F probably damaging Het
Fam35a A G 14: 34,268,172 V259A probably benign Het
Flt3l A T 7: 45,133,667 probably null Het
Fn1 T C 1: 71,628,071 Q834R probably benign Het
Haus5 C T 7: 30,658,976 W298* probably null Het
Ifih1 T C 2: 62,639,483 N157D possibly damaging Het
Itga2 A C 13: 114,843,473 M1064R probably benign Het
Itgae A G 11: 73,111,402 probably null Het
Krtap10-4 T C 10: 77,827,049 probably benign Het
Lamp3 A G 16: 19,699,681 C269R probably damaging Het
Lrp5 T C 19: 3,659,355 D125G probably damaging Het
Matn2 A C 15: 34,423,755 E586D probably benign Het
Mef2b T A 8: 70,164,139 probably null Het
Mrps22 A G 9: 98,601,471 probably null Het
Mtmr2 T C 9: 13,800,029 F445L probably damaging Het
Nxph4 A G 10: 127,526,368 V218A probably damaging Het
Olfr1308 C T 2: 111,960,746 G109D probably damaging Het
Olfr382 A G 11: 73,517,175 V8A probably benign Het
Olfr639 A G 7: 104,011,773 S310P probably benign Het
Pdpk1 A T 17: 24,106,922 V100D probably damaging Het
Phldb2 A C 16: 45,774,246 S899A probably benign Het
Pnpla3 G A 15: 84,172,782 probably null Het
Rlf A T 4: 121,148,822 I987N possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rprd2 A G 3: 95,780,441 Y300H probably damaging Het
Setbp1 G A 18: 78,783,369 S1343L probably benign Het
Sfswap A G 5: 129,571,041 K938E possibly damaging Het
Slc3a1 A C 17: 85,028,432 M1L probably damaging Het
Slco5a1 C T 1: 12,921,185 V427I probably benign Het
Ssbp2 A T 13: 91,690,908 M300L probably benign Het
Ssc5d A G 7: 4,937,522 D878G probably damaging Het
Stk19 A G 17: 34,824,598 L212P probably damaging Het
Stk39 T C 2: 68,410,043 M115V possibly damaging Het
Syt17 A C 7: 118,434,243 S181A probably benign Het
Taar7b A T 10: 23,999,951 N5Y probably benign Het
Tmc4 A G 7: 3,677,422 probably null Het
Tmem248 T A 5: 130,229,469 M1K probably null Het
Tmem82 T A 4: 141,616,410 Q183L probably damaging Het
Tpd52l1 T C 10: 31,338,207 E142G probably damaging Het
Ttll2 A T 17: 7,351,768 H253Q probably damaging Het
Ttn T C 2: 76,857,464 probably benign Het
Ubd A G 17: 37,195,501 K93E probably benign Het
Ugt2b35 T A 5: 87,001,556 F222Y probably damaging Het
Vmn2r10 G T 5: 109,003,462 N95K probably damaging Het
Vwa8 T C 14: 79,197,464 V1775A probably benign Het
Zdbf2 A G 1: 63,307,822 K1787E possibly damaging Het
Zfp26 A T 9: 20,437,286 F661I probably damaging Het
Zfp735 A T 11: 73,711,678 K483* probably null Het
Zfp946 A G 17: 22,454,538 E91G probably damaging Het
Zic5 C A 14: 122,459,749 D485Y unknown Het
Zmynd8 A T 2: 165,838,852 D236E probably damaging Het
Other mutations in Rasal2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Rasal2 APN 1 157147817 missense probably benign
IGL00484:Rasal2 APN 1 157174175 unclassified probably null
IGL00731:Rasal2 APN 1 157157764 missense probably benign 0.01
IGL00900:Rasal2 APN 1 157411929 missense possibly damaging 0.73
IGL01346:Rasal2 APN 1 157161216 missense probably benign 0.19
IGL01635:Rasal2 APN 1 157163824 missense probably damaging 1.00
IGL01759:Rasal2 APN 1 157175932 missense probably benign 0.42
IGL01939:Rasal2 APN 1 157175910 missense probably damaging 1.00
IGL01954:Rasal2 APN 1 157177699 missense possibly damaging 0.83
IGL01954:Rasal2 APN 1 157176116 missense probably damaging 0.99
IGL02005:Rasal2 APN 1 157156998 nonsense probably null
IGL02056:Rasal2 APN 1 157299261 missense probably damaging 0.99
IGL02444:Rasal2 APN 1 157299195 missense probably benign 0.20
IGL02496:Rasal2 APN 1 157149879 missense possibly damaging 0.69
IGL02832:Rasal2 APN 1 157157207 missense probably damaging 1.00
IGL03351:Rasal2 APN 1 157192741 splice site probably benign
R0456:Rasal2 UTSW 1 157149843 missense probably damaging 1.00
R0537:Rasal2 UTSW 1 157147792 missense possibly damaging 0.46
R0681:Rasal2 UTSW 1 157157180 missense possibly damaging 0.70
R0682:Rasal2 UTSW 1 157179209 missense probably damaging 1.00
R0683:Rasal2 UTSW 1 157179209 missense probably damaging 1.00
R0787:Rasal2 UTSW 1 157158696 missense probably damaging 1.00
R0789:Rasal2 UTSW 1 157157321 missense probably damaging 1.00
R1109:Rasal2 UTSW 1 157177638 unclassified probably benign
R1175:Rasal2 UTSW 1 157147648 missense probably damaging 1.00
R1332:Rasal2 UTSW 1 157175821 missense probably benign 0.00
R1396:Rasal2 UTSW 1 157164666 missense probably damaging 1.00
R1535:Rasal2 UTSW 1 157230059 missense probably benign 0.28
R1542:Rasal2 UTSW 1 157175851 missense possibly damaging 0.84
R1703:Rasal2 UTSW 1 157157600 missense probably damaging 1.00
R1735:Rasal2 UTSW 1 157174160 missense probably damaging 1.00
R1762:Rasal2 UTSW 1 157299144 missense possibly damaging 0.52
R2570:Rasal2 UTSW 1 157161300 missense possibly damaging 0.85
R3148:Rasal2 UTSW 1 157243764 intron probably benign
R3157:Rasal2 UTSW 1 157158655 splice site probably benign
R4277:Rasal2 UTSW 1 157157126 missense possibly damaging 0.46
R4459:Rasal2 UTSW 1 157175832 missense possibly damaging 0.46
R4460:Rasal2 UTSW 1 157175832 missense possibly damaging 0.46
R4563:Rasal2 UTSW 1 157175991 missense probably damaging 1.00
R4672:Rasal2 UTSW 1 157243661 missense probably benign 0.10
R4894:Rasal2 UTSW 1 157192804 missense probably damaging 0.97
R5147:Rasal2 UTSW 1 157175694 missense probably damaging 1.00
R5387:Rasal2 UTSW 1 157157765 missense possibly damaging 0.81
R5421:Rasal2 UTSW 1 157299141 missense probably benign 0.37
R5459:Rasal2 UTSW 1 157157661 missense probably damaging 0.99
R5651:Rasal2 UTSW 1 157157381 missense probably damaging 1.00
R5767:Rasal2 UTSW 1 157176162 missense probably damaging 1.00
R5778:Rasal2 UTSW 1 157161290 missense probably damaging 1.00
R6298:Rasal2 UTSW 1 157411862 missense possibly damaging 0.85
R6571:Rasal2 UTSW 1 157161179 missense possibly damaging 0.72
R7258:Rasal2 UTSW 1 157157700 missense probably damaging 0.96
R7545:Rasal2 UTSW 1 157192769 missense possibly damaging 0.93
R7558:Rasal2 UTSW 1 157175836 missense probably damaging 0.99
R7894:Rasal2 UTSW 1 157243648 missense probably benign 0.01
R7977:Rasal2 UTSW 1 157243648 missense probably benign 0.01
RF024:Rasal2 UTSW 1 157147790 missense probably damaging 0.97
Z1177:Rasal2 UTSW 1 157175673 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTTACACTACAGTTTATGGTTGC -3'
(R):5'- AAACAGCCTCCCATTGTCTC -3'

Sequencing Primer
(F):5'- CACTACAGTTTATGGTTGCTAGAGTC -3'
(R):5'- AGCCTCCCATTGTCTCAATGTAAAC -3'
Posted On2018-04-27