Incidental Mutation 'R6332:Olfr1308'
ID513156
Institutional Source Beutler Lab
Gene Symbol Olfr1308
Ensembl Gene ENSMUSG00000074952
Gene Nameolfactory receptor 1308
SynonymsMOR245-22, GA_x6K02T2Q125-73008844-73007882
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R6332 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location111959285-111964944 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 111960746 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 109 (G109D)
Ref Sequence ENSEMBL: ENSMUSP00000146688 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099605] [ENSMUST00000207560]
Predicted Effect probably damaging
Transcript: ENSMUST00000099605
AA Change: G109D

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097200
Gene: ENSMUSG00000074952
AA Change: G109D

DomainStartEndE-ValueType
Pfam:7tm_4 30 305 2.2e-39 PFAM
Pfam:7tm_1 41 287 3.1e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000207560
AA Change: G109D

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933421I07Rik C A 7: 42,446,243 G194C possibly damaging Het
Adamtsl1 A G 4: 86,217,011 K258E probably damaging Het
Afdn A T 17: 13,810,445 D206V possibly damaging Het
Agt G T 8: 124,557,833 Q389K possibly damaging Het
Ankrd44 A T 1: 54,762,273 D298E probably damaging Het
Anks1 A G 17: 28,052,735 S897G probably benign Het
Apol9b A G 15: 77,735,546 probably null Het
Baz1a T C 12: 54,918,554 E705G probably benign Het
BC048679 C T 7: 81,495,218 V126M probably benign Het
Cep295 A G 9: 15,334,914 F749L possibly damaging Het
Cntrl T A 2: 35,128,024 I482K possibly damaging Het
Col6a3 A G 1: 90,822,233 F293S probably damaging Het
Dnah12 T G 14: 26,717,974 M527R probably damaging Het
Dnhd1 G A 7: 105,694,066 R1539H probably benign Het
Ece1 A G 4: 137,958,008 Y603C probably damaging Het
Eea1 G A 10: 96,041,473 A1350T possibly damaging Het
Exoc3l4 A T 12: 111,427,968 K507N possibly damaging Het
Fam126b T A 1: 58,529,875 Y515F probably damaging Het
Fam35a A G 14: 34,268,172 V259A probably benign Het
Flt3l A T 7: 45,133,667 probably null Het
Fn1 T C 1: 71,628,071 Q834R probably benign Het
Haus5 C T 7: 30,658,976 W298* probably null Het
Ifih1 T C 2: 62,639,483 N157D possibly damaging Het
Itga2 A C 13: 114,843,473 M1064R probably benign Het
Itgae A G 11: 73,111,402 probably null Het
Krtap10-4 T C 10: 77,827,049 probably benign Het
Lamp3 A G 16: 19,699,681 C269R probably damaging Het
Lrp5 T C 19: 3,659,355 D125G probably damaging Het
Matn2 A C 15: 34,423,755 E586D probably benign Het
Mef2b T A 8: 70,164,139 probably null Het
Mrps22 A G 9: 98,601,471 probably null Het
Mtmr2 T C 9: 13,800,029 F445L probably damaging Het
Nxph4 A G 10: 127,526,368 V218A probably damaging Het
Olfr382 A G 11: 73,517,175 V8A probably benign Het
Olfr639 A G 7: 104,011,773 S310P probably benign Het
Pdpk1 A T 17: 24,106,922 V100D probably damaging Het
Phldb2 A C 16: 45,774,246 S899A probably benign Het
Pnpla3 G A 15: 84,172,782 probably null Het
Rasal2 A G 1: 157,299,187 Y94H probably damaging Het
Rlf A T 4: 121,148,822 I987N possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rprd2 A G 3: 95,780,441 Y300H probably damaging Het
Setbp1 G A 18: 78,783,369 S1343L probably benign Het
Sfswap A G 5: 129,571,041 K938E possibly damaging Het
Slc3a1 A C 17: 85,028,432 M1L probably damaging Het
Slco5a1 C T 1: 12,921,185 V427I probably benign Het
Ssbp2 A T 13: 91,690,908 M300L probably benign Het
Ssc5d A G 7: 4,937,522 D878G probably damaging Het
Stk19 A G 17: 34,824,598 L212P probably damaging Het
Stk39 T C 2: 68,410,043 M115V possibly damaging Het
Syt17 A C 7: 118,434,243 S181A probably benign Het
Taar7b A T 10: 23,999,951 N5Y probably benign Het
Tmc4 A G 7: 3,677,422 probably null Het
Tmem248 T A 5: 130,229,469 M1K probably null Het
Tmem82 T A 4: 141,616,410 Q183L probably damaging Het
Tpd52l1 T C 10: 31,338,207 E142G probably damaging Het
Ttll2 A T 17: 7,351,768 H253Q probably damaging Het
Ttn T C 2: 76,857,464 probably benign Het
Ubd A G 17: 37,195,501 K93E probably benign Het
Ugt2b35 T A 5: 87,001,556 F222Y probably damaging Het
Vmn2r10 G T 5: 109,003,462 N95K probably damaging Het
Vwa8 T C 14: 79,197,464 V1775A probably benign Het
Zdbf2 A G 1: 63,307,822 K1787E possibly damaging Het
Zfp26 A T 9: 20,437,286 F661I probably damaging Het
Zfp735 A T 11: 73,711,678 K483* probably null Het
Zfp946 A G 17: 22,454,538 E91G probably damaging Het
Zic5 C A 14: 122,459,749 D485Y unknown Het
Zmynd8 A T 2: 165,838,852 D236E probably damaging Het
Other mutations in Olfr1308
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01317:Olfr1308 APN 2 111960275 missense possibly damaging 0.84
IGL01359:Olfr1308 APN 2 111961061 missense probably benign
IGL01731:Olfr1308 APN 2 111960635 missense probably benign 0.03
IGL01788:Olfr1308 APN 2 111961007 missense probably benign
IGL02385:Olfr1308 APN 2 111960258 missense probably benign 0.00
IGL02969:Olfr1308 APN 2 111960567 missense probably damaging 1.00
R0102:Olfr1308 UTSW 2 111960597 missense probably damaging 1.00
R0102:Olfr1308 UTSW 2 111960597 missense probably damaging 1.00
R0244:Olfr1308 UTSW 2 111961016 missense probably benign 0.13
R0265:Olfr1308 UTSW 2 111960494 missense probably damaging 0.99
R1268:Olfr1308 UTSW 2 111960877 missense possibly damaging 0.78
R1406:Olfr1308 UTSW 2 111960581 missense probably benign 0.07
R1406:Olfr1308 UTSW 2 111960581 missense probably benign 0.07
R1568:Olfr1308 UTSW 2 111960240 missense probably benign 0.02
R2401:Olfr1308 UTSW 2 111960149 missense probably benign 0.01
R4396:Olfr1308 UTSW 2 111960215 missense probably damaging 1.00
R4528:Olfr1308 UTSW 2 111960948 missense probably damaging 1.00
R5916:Olfr1308 UTSW 2 111960830 missense probably damaging 1.00
R6595:Olfr1308 UTSW 2 111960170 missense possibly damaging 0.95
R7339:Olfr1308 UTSW 2 111960611 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TTGATGAACCGGGGAAAGTCAC -3'
(R):5'- GGCATCTGACCCTCATTTACAC -3'

Sequencing Primer
(F):5'- AACACATTTGGTCCACAGAATG -3'
(R):5'- ACACTCTCCAATGTACTTTCTGTTGG -3'
Posted On2018-04-27