Incidental Mutation 'R6332:Vmn2r10'
ID513164
Institutional Source Beutler Lab
Gene Symbol Vmn2r10
Ensembl Gene ENSMUSG00000067010
Gene Namevomeronasal 2, receptor 10
SynonymsV2r16, VR16
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R6332 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location108993412-109006471 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 109003462 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 95 (N95K)
Ref Sequence ENSEMBL: ENSMUSP00000078162 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079163] [ENSMUST00000176594]
Predicted Effect probably damaging
Transcript: ENSMUST00000079163
AA Change: N95K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078162
Gene: ENSMUSG00000067010
AA Change: N95K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 75 464 8.5e-29 PFAM
Pfam:NCD3G 506 560 3.8e-17 PFAM
Pfam:7tm_3 593 828 4e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176594
SMART Domains Protein: ENSMUSP00000135274
Gene: ENSMUSG00000067010

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 99% (67/68)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933421I07Rik C A 7: 42,446,243 G194C possibly damaging Het
Adamtsl1 A G 4: 86,217,011 K258E probably damaging Het
Afdn A T 17: 13,810,445 D206V possibly damaging Het
Agt G T 8: 124,557,833 Q389K possibly damaging Het
Ankrd44 A T 1: 54,762,273 D298E probably damaging Het
Anks1 A G 17: 28,052,735 S897G probably benign Het
Apol9b A G 15: 77,735,546 probably null Het
Baz1a T C 12: 54,918,554 E705G probably benign Het
BC048679 C T 7: 81,495,218 V126M probably benign Het
Cep295 A G 9: 15,334,914 F749L possibly damaging Het
Cntrl T A 2: 35,128,024 I482K possibly damaging Het
Col6a3 A G 1: 90,822,233 F293S probably damaging Het
Dnah12 T G 14: 26,717,974 M527R probably damaging Het
Dnhd1 G A 7: 105,694,066 R1539H probably benign Het
Ece1 A G 4: 137,958,008 Y603C probably damaging Het
Eea1 G A 10: 96,041,473 A1350T possibly damaging Het
Exoc3l4 A T 12: 111,427,968 K507N possibly damaging Het
Fam126b T A 1: 58,529,875 Y515F probably damaging Het
Fam35a A G 14: 34,268,172 V259A probably benign Het
Flt3l A T 7: 45,133,667 probably null Het
Fn1 T C 1: 71,628,071 Q834R probably benign Het
Haus5 C T 7: 30,658,976 W298* probably null Het
Ifih1 T C 2: 62,639,483 N157D possibly damaging Het
Itga2 A C 13: 114,843,473 M1064R probably benign Het
Itgae A G 11: 73,111,402 probably null Het
Krtap10-4 T C 10: 77,827,049 probably benign Het
Lamp3 A G 16: 19,699,681 C269R probably damaging Het
Lrp5 T C 19: 3,659,355 D125G probably damaging Het
Matn2 A C 15: 34,423,755 E586D probably benign Het
Mef2b T A 8: 70,164,139 probably null Het
Mrps22 A G 9: 98,601,471 probably null Het
Mtmr2 T C 9: 13,800,029 F445L probably damaging Het
Nxph4 A G 10: 127,526,368 V218A probably damaging Het
Olfr1308 C T 2: 111,960,746 G109D probably damaging Het
Olfr382 A G 11: 73,517,175 V8A probably benign Het
Olfr639 A G 7: 104,011,773 S310P probably benign Het
Pdpk1 A T 17: 24,106,922 V100D probably damaging Het
Phldb2 A C 16: 45,774,246 S899A probably benign Het
Pnpla3 G A 15: 84,172,782 probably null Het
Rasal2 A G 1: 157,299,187 Y94H probably damaging Het
Rlf A T 4: 121,148,822 I987N possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rprd2 A G 3: 95,780,441 Y300H probably damaging Het
Setbp1 G A 18: 78,783,369 S1343L probably benign Het
Sfswap A G 5: 129,571,041 K938E possibly damaging Het
Slc3a1 A C 17: 85,028,432 M1L probably damaging Het
Slco5a1 C T 1: 12,921,185 V427I probably benign Het
Ssbp2 A T 13: 91,690,908 M300L probably benign Het
Ssc5d A G 7: 4,937,522 D878G probably damaging Het
Stk19 A G 17: 34,824,598 L212P probably damaging Het
Stk39 T C 2: 68,410,043 M115V possibly damaging Het
Syt17 A C 7: 118,434,243 S181A probably benign Het
Taar7b A T 10: 23,999,951 N5Y probably benign Het
Tmc4 A G 7: 3,677,422 probably null Het
Tmem248 T A 5: 130,229,469 M1K probably null Het
Tmem82 T A 4: 141,616,410 Q183L probably damaging Het
Tpd52l1 T C 10: 31,338,207 E142G probably damaging Het
Ttll2 A T 17: 7,351,768 H253Q probably damaging Het
Ttn T C 2: 76,857,464 probably benign Het
Ubd A G 17: 37,195,501 K93E probably benign Het
Ugt2b35 T A 5: 87,001,556 F222Y probably damaging Het
Vwa8 T C 14: 79,197,464 V1775A probably benign Het
Zdbf2 A G 1: 63,307,822 K1787E possibly damaging Het
Zfp26 A T 9: 20,437,286 F661I probably damaging Het
Zfp735 A T 11: 73,711,678 K483* probably null Het
Zfp946 A G 17: 22,454,538 E91G probably damaging Het
Zic5 C A 14: 122,459,749 D485Y unknown Het
Zmynd8 A T 2: 165,838,852 D236E probably damaging Het
Other mutations in Vmn2r10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:Vmn2r10 APN 5 109002585 missense possibly damaging 0.75
IGL01618:Vmn2r10 APN 5 109002479 missense probably damaging 1.00
IGL01624:Vmn2r10 APN 5 109006246 missense possibly damaging 0.83
IGL01941:Vmn2r10 APN 5 108995954 missense probably damaging 1.00
IGL01959:Vmn2r10 APN 5 108997705 missense probably benign 0.00
IGL01973:Vmn2r10 APN 5 108995677 missense probably damaging 1.00
IGL01985:Vmn2r10 APN 5 109006259 missense probably benign 0.21
IGL02451:Vmn2r10 APN 5 108995922 nonsense probably null
IGL02503:Vmn2r10 APN 5 109003475 missense probably damaging 1.00
IGL03275:Vmn2r10 APN 5 109003377 missense probably benign 0.00
R0035:Vmn2r10 UTSW 5 108997601 splice site probably benign
R0395:Vmn2r10 UTSW 5 109001993 missense probably damaging 1.00
R0454:Vmn2r10 UTSW 5 109003461 missense probably benign 0.25
R0648:Vmn2r10 UTSW 5 108995916 missense probably benign 0.00
R1251:Vmn2r10 UTSW 5 108996024 missense probably benign 0.01
R1580:Vmn2r10 UTSW 5 109006251 missense possibly damaging 0.82
R1845:Vmn2r10 UTSW 5 109001995 nonsense probably null
R1986:Vmn2r10 UTSW 5 109006254 nonsense probably null
R2137:Vmn2r10 UTSW 5 109003544 missense possibly damaging 0.87
R2495:Vmn2r10 UTSW 5 108996095 missense probably damaging 1.00
R3932:Vmn2r10 UTSW 5 109002222 missense possibly damaging 0.47
R3933:Vmn2r10 UTSW 5 109002222 missense possibly damaging 0.47
R4899:Vmn2r10 UTSW 5 109003458 missense probably damaging 1.00
R4992:Vmn2r10 UTSW 5 108997726 missense possibly damaging 0.89
R5124:Vmn2r10 UTSW 5 109006420 missense probably benign 0.01
R5145:Vmn2r10 UTSW 5 108995895 missense possibly damaging 0.64
R5156:Vmn2r10 UTSW 5 108995600 missense probably benign 0.11
R5265:Vmn2r10 UTSW 5 108995720 missense probably damaging 1.00
R5311:Vmn2r10 UTSW 5 109006255 missense probably damaging 1.00
R5321:Vmn2r10 UTSW 5 108995639 missense probably damaging 1.00
R5666:Vmn2r10 UTSW 5 108999044 nonsense probably null
R5670:Vmn2r10 UTSW 5 108999044 nonsense probably null
R5872:Vmn2r10 UTSW 5 109003511 missense possibly damaging 0.84
R6004:Vmn2r10 UTSW 5 108999078 missense probably benign 0.30
R6108:Vmn2r10 UTSW 5 108995801 missense probably damaging 1.00
R6599:Vmn2r10 UTSW 5 108996078 missense probably benign 0.09
R6651:Vmn2r10 UTSW 5 108995622 missense probably null 0.22
R6891:Vmn2r10 UTSW 5 109001979 missense probably damaging 1.00
R7023:Vmn2r10 UTSW 5 109002028 missense probably damaging 0.96
R7146:Vmn2r10 UTSW 5 109003334 missense probably damaging 1.00
R8058:Vmn2r10 UTSW 5 109002089 missense probably benign 0.00
Z1088:Vmn2r10 UTSW 5 108996113 missense probably damaging 1.00
Z1176:Vmn2r10 UTSW 5 109001988 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGTGTCCCAGAATTAATTGACAG -3'
(R):5'- CAAGGTTGGCATTCAGAGATAAAAC -3'

Sequencing Primer
(F):5'- TGACAGTTTTATTGATGTTTTCCATG -3'
(R):5'- ACATAGTGCCCTATTTCTATGAGTTC -3'
Posted On2018-04-27