Mutagenetix > Incidental Mutation

Incidental Mutation 'R6332:Ssc5d'

513168

Institutional Source

Beutler Lab

Gene Symbol

Ssc5d

Ensembl Gene

ENSMUSG00000035279

Gene Name

scavenger receptor cysteine rich family, 5 domains

Synonyms

s5d-srcrb, A430110N23Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6332 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

4925785-4944826 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 4937522 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 878 (D878G)

Ref Sequence

ENSEMBL: ENSMUSP00000052126 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057612] [ENSMUST00000208109]

AlphaFold

Q8BV57

Predicted Effect

probably damaging
Transcript: ENSMUST00000057612
AA Change: D878G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000052126
Gene: ENSMUSG00000035279
AA Change: D878G

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
SR	20	120	4.44e-49	SMART
low complexity region	141	155	N/A	INTRINSIC
low complexity region	167	182	N/A	INTRINSIC
SR	199	299	2.36e-53	SMART
SR	305	405	8.22e-53	SMART
low complexity region	437	462	N/A	INTRINSIC
SR	464	565	1.11e-49	SMART
low complexity region	741	755	N/A	INTRINSIC
SR	758	858	3.93e-50	SMART
low complexity region	936	957	N/A	INTRINSIC
low complexity region	981	1004	N/A	INTRINSIC
low complexity region	1018	1035	N/A	INTRINSIC
low complexity region	1218	1230	N/A	INTRINSIC
low complexity region	1357	1364	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207310

Predicted Effect

probably benign
Transcript: ENSMUST00000208109

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.2%

Validation Efficiency

99% (67/68)

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933421I07Rik	C	A	7: 42,446,243	G194C	possibly damaging	Het
Adamtsl1	A	G	4: 86,217,011	K258E	probably damaging	Het
Afdn	A	T	17: 13,810,445	D206V	possibly damaging	Het
Agt	G	T	8: 124,557,833	Q389K	possibly damaging	Het
Ankrd44	A	T	1: 54,762,273	D298E	probably damaging	Het
Anks1	A	G	17: 28,052,735	S897G	probably benign	Het
Apol9b	A	G	15: 77,735,546		probably null	Het
Baz1a	T	C	12: 54,918,554	E705G	probably benign	Het
BC048679	C	T	7: 81,495,218	V126M	probably benign	Het
Cep295	A	G	9: 15,334,914	F749L	possibly damaging	Het
Cntrl	T	A	2: 35,128,024	I482K	possibly damaging	Het
Col6a3	A	G	1: 90,822,233	F293S	probably damaging	Het
Dnah12	T	G	14: 26,717,974	M527R	probably damaging	Het
Dnhd1	G	A	7: 105,694,066	R1539H	probably benign	Het
Ece1	A	G	4: 137,958,008	Y603C	probably damaging	Het
Eea1	G	A	10: 96,041,473	A1350T	possibly damaging	Het
Exoc3l4	A	T	12: 111,427,968	K507N	possibly damaging	Het
Fam126b	T	A	1: 58,529,875	Y515F	probably damaging	Het
Fam35a	A	G	14: 34,268,172	V259A	probably benign	Het
Flt3l	A	T	7: 45,133,667		probably null	Het
Fn1	T	C	1: 71,628,071	Q834R	probably benign	Het
Haus5	C	T	7: 30,658,976	W298*	probably null	Het
Ifih1	T	C	2: 62,639,483	N157D	possibly damaging	Het
Itga2	A	C	13: 114,843,473	M1064R	probably benign	Het
Itgae	A	G	11: 73,111,402		probably null	Het
Krtap10-4	T	C	10: 77,827,049		probably benign	Het
Lamp3	A	G	16: 19,699,681	C269R	probably damaging	Het
Lrp5	T	C	19: 3,659,355	D125G	probably damaging	Het
Matn2	A	C	15: 34,423,755	E586D	probably benign	Het
Mef2b	T	A	8: 70,164,139		probably null	Het
Mrps22	A	G	9: 98,601,471		probably null	Het
Mtmr2	T	C	9: 13,800,029	F445L	probably damaging	Het
Nxph4	A	G	10: 127,526,368	V218A	probably damaging	Het
Olfr1308	C	T	2: 111,960,746	G109D	probably damaging	Het
Olfr382	A	G	11: 73,517,175	V8A	probably benign	Het
Olfr639	A	G	7: 104,011,773	S310P	probably benign	Het
Pdpk1	A	T	17: 24,106,922	V100D	probably damaging	Het
Phldb2	A	C	16: 45,774,246	S899A	probably benign	Het
Pnpla3	G	A	15: 84,172,782		probably null	Het
Rasal2	A	G	1: 157,299,187	Y94H	probably damaging	Het
Rlf	A	T	4: 121,148,822	I987N	possibly damaging	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
Rprd2	A	G	3: 95,780,441	Y300H	probably damaging	Het
Setbp1	G	A	18: 78,783,369	S1343L	probably benign	Het
Sfswap	A	G	5: 129,571,041	K938E	possibly damaging	Het
Slc3a1	A	C	17: 85,028,432	M1L	probably damaging	Het
Slco5a1	C	T	1: 12,921,185	V427I	probably benign	Het
Ssbp2	A	T	13: 91,690,908	M300L	probably benign	Het
Stk19	A	G	17: 34,824,598	L212P	probably damaging	Het
Stk39	T	C	2: 68,410,043	M115V	possibly damaging	Het
Syt17	A	C	7: 118,434,243	S181A	probably benign	Het
Taar7b	A	T	10: 23,999,951	N5Y	probably benign	Het
Tmc4	A	G	7: 3,677,422		probably null	Het
Tmem248	T	A	5: 130,229,469	M1K	probably null	Het
Tmem82	T	A	4: 141,616,410	Q183L	probably damaging	Het
Tpd52l1	T	C	10: 31,338,207	E142G	probably damaging	Het
Ttll2	A	T	17: 7,351,768	H253Q	probably damaging	Het
Ttn	T	C	2: 76,857,464		probably benign	Het
Ubd	A	G	17: 37,195,501	K93E	probably benign	Het
Ugt2b35	T	A	5: 87,001,556	F222Y	probably damaging	Het
Vmn2r10	G	T	5: 109,003,462	N95K	probably damaging	Het
Vwa8	T	C	14: 79,197,464	V1775A	probably benign	Het
Zdbf2	A	G	1: 63,307,822	K1787E	possibly damaging	Het
Zfp26	A	T	9: 20,437,286	F661I	probably damaging	Het
Zfp735	A	T	11: 73,711,678	K483*	probably null	Het
Zfp946	A	G	17: 22,454,538	E91G	probably damaging	Het
Zic5	C	A	14: 122,459,749	D485Y	unknown	Het
Zmynd8	A	T	2: 165,838,852	D236E	probably damaging	Het

Other mutations in Ssc5d

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00325:Ssc5d	APN	7	4944481	missense	possibly damaging	0.63
IGL00939:Ssc5d	APN	7	4936281	missense	possibly damaging	0.89
IGL01109:Ssc5d	APN	7	4937112	nonsense	probably null
IGL01409:Ssc5d	APN	7	4942809	missense	probably benign	0.16
IGL01880:Ssc5d	APN	7	4933219	missense	probably damaging	1.00
IGL02013:Ssc5d	APN	7	4943836	missense	probably benign	0.00
IGL02227:Ssc5d	APN	7	4933454	critical splice donor site	probably null
IGL02963:Ssc5d	APN	7	4944327	missense	probably benign	0.02
D4043:Ssc5d	UTSW	7	4943983	missense	possibly damaging	0.70
D4216:Ssc5d	UTSW	7	4943983	missense	possibly damaging	0.70
R0104:Ssc5d	UTSW	7	4936286	missense	probably benign	0.41
R0115:Ssc5d	UTSW	7	4927881	unclassified	probably benign
R0201:Ssc5d	UTSW	7	4944663	missense	probably benign
R0365:Ssc5d	UTSW	7	4928467	nonsense	probably null
R0485:Ssc5d	UTSW	7	4937471	missense	probably damaging	0.99
R0967:Ssc5d	UTSW	7	4944343	nonsense	probably null
R1607:Ssc5d	UTSW	7	4944043	missense	probably benign	0.25
R1639:Ssc5d	UTSW	7	4928417	missense	probably damaging	1.00
R1801:Ssc5d	UTSW	7	4936607	missense	probably benign	0.05
R1867:Ssc5d	UTSW	7	4928507	missense	probably damaging	1.00
R1999:Ssc5d	UTSW	7	4942714	missense	possibly damaging	0.86
R2007:Ssc5d	UTSW	7	4928629	missense	probably damaging	1.00
R2084:Ssc5d	UTSW	7	4937012	missense	probably benign	0.01
R2234:Ssc5d	UTSW	7	4943850	missense	probably benign
R2259:Ssc5d	UTSW	7	4943916	missense	probably benign	0.01
R2567:Ssc5d	UTSW	7	4936335	missense	probably damaging	1.00
R2879:Ssc5d	UTSW	7	4936907	critical splice acceptor site	probably null
R3782:Ssc5d	UTSW	7	4942791	missense	probably benign	0.00
R3875:Ssc5d	UTSW	7	4927262	missense	probably damaging	1.00
R4322:Ssc5d	UTSW	7	4928450	missense	probably damaging	1.00
R4331:Ssc5d	UTSW	7	4942726	missense	probably benign	0.00
R4334:Ssc5d	UTSW	7	4943664	missense	probably benign
R4430:Ssc5d	UTSW	7	4943664	missense	probably benign
R4619:Ssc5d	UTSW	7	4929525	missense	probably damaging	1.00
R4794:Ssc5d	UTSW	7	4943745	missense	probably benign
R5106:Ssc5d	UTSW	7	4936665	missense	probably benign	0.31
R5174:Ssc5d	UTSW	7	4927971	missense	possibly damaging	0.83
R5553:Ssc5d	UTSW	7	4936290	missense	probably damaging	1.00
R5649:Ssc5d	UTSW	7	4926518	critical splice donor site	probably null
R5786:Ssc5d	UTSW	7	4936818	missense	probably benign	0.00
R6059:Ssc5d	UTSW	7	4942744	missense	possibly damaging	0.86
R6163:Ssc5d	UTSW	7	4927254	missense	probably damaging	1.00
R6341:Ssc5d	UTSW	7	4936665	missense	probably benign	0.31
R6613:Ssc5d	UTSW	7	4933293	missense	possibly damaging	0.82
R7180:Ssc5d	UTSW	7	4936601	missense	probably benign	0.17
R7576:Ssc5d	UTSW	7	4928573	missense	probably damaging	1.00
R7602:Ssc5d	UTSW	7	4942746	missense	possibly damaging	0.95
R7609:Ssc5d	UTSW	7	4927576	missense	possibly damaging	0.56
R7691:Ssc5d	UTSW	7	4944169	missense	probably benign	0.29
R7759:Ssc5d	UTSW	7	4937530	nonsense	probably null
R8480:Ssc5d	UTSW	7	4936329	missense	probably damaging	1.00
R9029:Ssc5d	UTSW	7	4927920	missense	probably damaging	0.97
R9163:Ssc5d	UTSW	7	4933433	missense	probably damaging	1.00
R9178:Ssc5d	UTSW	7	4927059	missense	probably damaging	1.00
R9181:Ssc5d	UTSW	7	4942815	missense	possibly damaging	0.86
R9382:Ssc5d	UTSW	7	4927284	critical splice donor site	probably null
R9489:Ssc5d	UTSW	7	4937600	missense	probably benign	0.02
R9626:Ssc5d	UTSW	7	4943569	missense	probably benign
R9630:Ssc5d	UTSW	7	4936427	missense	probably damaging	1.00
R9776:Ssc5d	UTSW	7	4929368	missense	probably benign	0.07
X0063:Ssc5d	UTSW	7	4936287	missense	probably damaging	1.00
Z1088:Ssc5d	UTSW	7	4928434	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGCGTTGGTGTCTAAAGGTC -3'
(R):5'- AGAGCTCCACCATTTTGACTC -3'

Sequencing Primer
(F):5'- TGGTGTCTAAAGGTCTAAGGAGC -3'
(R):5'- TGACTCTGACCTCATCACACATG -3'

Posted On

2018-04-27